Incidental Mutation 'R5161:P2ry2'
ID396994
Institutional Source Beutler Lab
Gene Symbol P2ry2
Ensembl Gene ENSMUSG00000032860
Gene Namepurinergic receptor P2Y, G-protein coupled 2
SynonymsP2Y2
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100996568-101012866 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 100998929 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 56 (Y56*)
Ref Sequence ENSEMBL: ENSMUSP00000146679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037540] [ENSMUST00000178340] [ENSMUST00000207049] [ENSMUST00000207916] [ENSMUST00000208340]
Predicted Effect probably null
Transcript: ENSMUST00000037540
AA Change: Y56*
SMART Domains Protein: ENSMUSP00000036765
Gene: ENSMUSG00000032860
AA Change: Y56*

DomainStartEndE-ValueType
Pfam:7tm_1 50 306 3.7e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178340
AA Change: Y56*
SMART Domains Protein: ENSMUSP00000137152
Gene: ENSMUSG00000032860
AA Change: Y56*

DomainStartEndE-ValueType
Pfam:7tm_1 50 306 2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207049
Predicted Effect probably null
Transcript: ENSMUST00000207916
AA Change: Y56*
Predicted Effect probably null
Transcript: ENSMUST00000208340
AA Change: Y56*
Meta Mutation Damage Score 0.6428 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, found on many cell types, is activated by ATP and UTP and is reported to be overexpressed on some cancer cell types. It is involved in many cellular functions, such as proliferation, apoptosis and inflammation. Three transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display reduced nucleotide-stimulated calcium secretion from lung fibroblasts and nasal and tracheal epithelial cells and chloride secretion from trachea and gallbladder. Induction of neuronal differentiationby ATPgammaS is abolished. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in P2ry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:P2ry2 APN 7 100998186 missense probably damaging 0.99
IGL02221:P2ry2 APN 7 100998114 missense possibly damaging 0.86
R0567:P2ry2 UTSW 7 100998541 missense probably damaging 1.00
R1882:P2ry2 UTSW 7 100998851 nonsense probably null
R2483:P2ry2 UTSW 7 100998499 missense probably benign 0.12
R3623:P2ry2 UTSW 7 100998499 missense probably benign 0.12
R4193:P2ry2 UTSW 7 100998450 missense probably benign 0.01
R4559:P2ry2 UTSW 7 100998156 missense possibly damaging 0.89
R6021:P2ry2 UTSW 7 100998400 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGGAAACGCACCAGCTTG -3'
(R):5'- GGCAAATCTTAGCAAGTCCCC -3'

Sequencing Primer
(F):5'- ACGCACCAGCTTGCAGAG -3'
(R):5'- TGAGCCCAGACATGACAGCTTTC -3'
Posted On2016-06-21