Incidental Mutation 'R5161:Ctsd'
ID396997
Institutional Source Beutler Lab
Gene Symbol Ctsd
Ensembl Gene ENSMUSG00000007891
Gene Namecathepsin D
SynonymsCD, CatD
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location142375911-142388038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142377144 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 283 (L283Q)
Ref Sequence ENSEMBL: ENSMUSP00000121203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059223] [ENSMUST00000066401] [ENSMUST00000084412] [ENSMUST00000105988] [ENSMUST00000151120]
Predicted Effect probably benign
Transcript: ENSMUST00000059223
SMART Domains Protein: ENSMUSP00000062728
Gene: ENSMUSG00000045777

DomainStartEndE-ValueType
Pfam:Dispanin 38 108 6.5e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000066401
AA Change: L277Q
SMART Domains Protein: ENSMUSP00000063904
Gene: ENSMUSG00000007891
AA Change: L277Q

DomainStartEndE-ValueType
Pfam:A1_Propeptide 21 49 1.7e-11 PFAM
Pfam:Asp 78 274 1.6e-75 PFAM
Pfam:TAXi_N 79 246 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084412
SMART Domains Protein: ENSMUSP00000081450
Gene: ENSMUSG00000045777

DomainStartEndE-ValueType
Pfam:Dispanin 38 121 9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105988
SMART Domains Protein: ENSMUSP00000101608
Gene: ENSMUSG00000045777

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
Pfam:CD225 115 191 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123543
Predicted Effect unknown
Transcript: ENSMUST00000133843
AA Change: L151Q
SMART Domains Protein: ENSMUSP00000117247
Gene: ENSMUSG00000110040
AA Change: L151Q

DomainStartEndE-ValueType
Pfam:Asp 1 249 4.5e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140032
Predicted Effect probably damaging
Transcript: ENSMUST00000151120
AA Change: L283Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121203
Gene: ENSMUSG00000007891
AA Change: L283Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:A1_Propeptide 21 48 6.9e-11 PFAM
Pfam:Asp 78 407 4.7e-123 PFAM
Pfam:TAXi_N 79 247 2.1e-10 PFAM
Pfam:TAXi_C 326 406 6.4e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000209263
AA Change: L83Q
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the A1 family of peptidases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the cathepsin D light and heavy chains, which heterodimerize to form the mature enzyme. This enzyme exhibits pepsin-like activity and plays a role in protein turnover and in the proteolytic activation of hormones and growth factors. Mutations in this gene play a causal role in neuronal ceroid lipofuscinosis-10 and may be involved in the pathogenesis of several other diseases, including breast cancer and possibly Alzheimer's disease. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null mutation die in a state of anorexia at ~P26, displaying severe atrophy of the intestinal mucosa, and massive destruction of the thymus and spleen with loss of T and B cells; near the terminal stage, affected mice have seizures,display retinal atrophy, and become blind. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Ctsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ctsd APN 7 142382681 missense probably damaging 1.00
IGL01963:Ctsd APN 7 142376599 critical splice donor site probably null
IGL02021:Ctsd APN 7 142385476 missense probably damaging 0.99
twiggy UTSW 7 142377144 missense probably damaging 1.00
R5533:Ctsd UTSW 7 142377333 missense probably benign 0.00
R5762:Ctsd UTSW 7 142383529 missense probably damaging 1.00
R5933:Ctsd UTSW 7 142376579 missense probably benign 0.00
R6031:Ctsd UTSW 7 142376714 missense probably damaging 1.00
R6365:Ctsd UTSW 7 142385577 missense probably benign 0.37
R6721:Ctsd UTSW 7 142376853 missense possibly damaging 0.77
X0025:Ctsd UTSW 7 142376844 missense probably damaging 1.00
Z1088:Ctsd UTSW 7 142376597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAAGGTATGGTCTCGGGAAC -3'
(R):5'- ACGTCACTCGAAAGGCCTAC -3'

Sequencing Primer
(F):5'- GAACCCTCTCTGCCTGCTGG -3'
(R):5'- TGCACATGGACCAGTGAGTC -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R51610029_PCR_F: 5’- ATTGAAGGTATGGTCTCGGGAAC-3’

R51610029_PCR_R: 5’- ACGTCACTCGAAAGGCCTAC-3’

 

Sequencing Primers

R51610029_SEQ_F: 5’- GAACCCTCTCTGCCTGCTGG-3’
 

R51610029_SEQ_R: 5’- TGCACATGGACCAGTGAGTC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 412 nucleotides is amplified (Chr7: 142376961-142377372; NCBI RefSeq: NC_000073):

 

attgaaggta tggtctcggg aaccctctct gcctgctggc cagcccacac aggccagtag       

cttacctcac cctggataag aggcactgcc ccgatggcct tctgcagctc cttcacctct      

tccacaggcc ccaccagaag agatgtccct gtgtccacaa tagcctcaca gcctcccttg      

cacagggtca gctcattgcc cacctccaac ctatgaggca aatatgtatc agtcacttta      

ccctgtcaca ggtgagtata gggcatagct tgtctagacc ctgccttgga agacacctgc      

tttttttgcc caggcttccc gcacatcacc cctacataat actcccagcc cccagcgaca      

cccacgactc actggtccat gtgcacctgc cagtaggcct ttcgagtgac gt

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>T).

Posted On2016-06-21