Incidental Mutation 'R5161:Slc5a5'
ID396999
Institutional Source Beutler Lab
Gene Symbol Slc5a5
Ensembl Gene ENSMUSG00000000792
Gene Namesolute carrier family 5 (sodium iodide symporter), member 5
SynonymsNIS
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5161 (G1)
Quality Score178
Status Validated
Chromosome8
Chromosomal Location70882889-70892757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 70888848 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 346 (C346G)
Ref Sequence ENSEMBL: ENSMUSP00000000809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000809]
Predicted Effect probably damaging
Transcript: ENSMUST00000000809
AA Change: C346G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: C346G

DomainStartEndE-ValueType
Pfam:SSF 47 452 2.5e-43 PFAM
transmembrane domain 522 544 N/A INTRINSIC
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Slc5a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Slc5a5 APN 8 70888537 missense probably damaging 0.99
IGL01372:Slc5a5 APN 8 70890376 unclassified probably benign
IGL01394:Slc5a5 APN 8 70889388 nonsense probably null
IGL01571:Slc5a5 APN 8 70891332 unclassified probably benign
IGL02043:Slc5a5 APN 8 70892429 missense possibly damaging 0.84
IGL02186:Slc5a5 APN 8 70886120 missense possibly damaging 0.79
IGL02479:Slc5a5 APN 8 70888911 missense possibly damaging 0.67
IGL02559:Slc5a5 APN 8 70890271 missense probably damaging 1.00
IGL02892:Slc5a5 APN 8 70892517 missense probably damaging 1.00
IGL03388:Slc5a5 APN 8 70890328 missense probably benign 0.45
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0413:Slc5a5 UTSW 8 70891675 missense possibly damaging 0.63
R0662:Slc5a5 UTSW 8 70883875 missense probably benign 0.01
R0781:Slc5a5 UTSW 8 70890220 missense probably benign 0.19
R1061:Slc5a5 UTSW 8 70890221 missense probably benign 0.00
R1400:Slc5a5 UTSW 8 70889435 missense possibly damaging 0.87
R1524:Slc5a5 UTSW 8 70892334 missense probably damaging 1.00
R2033:Slc5a5 UTSW 8 70888587 missense probably damaging 0.99
R2072:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2075:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2110:Slc5a5 UTSW 8 70889751 intron probably null
R2111:Slc5a5 UTSW 8 70889751 intron probably null
R2112:Slc5a5 UTSW 8 70889751 intron probably null
R2201:Slc5a5 UTSW 8 70892458 missense probably damaging 0.98
R3978:Slc5a5 UTSW 8 70889395 missense probably benign 0.00
R4244:Slc5a5 UTSW 8 70890286 missense probably benign
R5397:Slc5a5 UTSW 8 70891179 missense probably damaging 1.00
R5718:Slc5a5 UTSW 8 70887755 missense probably benign 0.00
R5740:Slc5a5 UTSW 8 70888917 splice site probably null
R5869:Slc5a5 UTSW 8 70892330 missense probably damaging 1.00
R6268:Slc5a5 UTSW 8 70888620 missense probably damaging 1.00
R6290:Slc5a5 UTSW 8 70891178 missense probably damaging 1.00
R6292:Slc5a5 UTSW 8 70891178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTTAGGACACCCCGAG -3'
(R):5'- ATGATAGCTGGACTCTTCCTTTTG -3'

Sequencing Primer
(F):5'- TCTTAGGACACCCCGAGAGAGC -3'
(R):5'- TTGTTGAGATAGGGCTTCATGTAGC -3'
Posted On2016-06-21