Incidental Mutation 'R5162:Man1b1'
ID397032
Institutional Source Beutler Lab
Gene Symbol Man1b1
Ensembl Gene ENSMUSG00000036646
Gene Namemannosidase, alpha, class 1B, member 1
SynonymsLOC227619, E430019H13Rik, MANA-ER
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25332338-25352212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25343353 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 246 (L246Q)
Ref Sequence ENSEMBL: ENSMUSP00000036996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042390] [ENSMUST00000136245]
Predicted Effect probably damaging
Transcript: ENSMUST00000042390
AA Change: L246Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036996
Gene: ENSMUSG00000036646
AA Change: L246Q

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 29 42 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
Pfam:Glyco_hydro_47 215 654 9.5e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131826
Predicted Effect probably benign
Transcript: ENSMUST00000136245
SMART Domains Protein: ENSMUSP00000114989
Gene: ENSMUSG00000036646

DomainStartEndE-ValueType
transmembrane domain 68 87 N/A INTRINSIC
PDB:1X9D|A 145 238 9e-21 PDB
SCOP:d1fo3a_ 217 237 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157546
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme functions in N-glycan biosynthesis, and is a class I alpha-1,2-mannosidase that specifically converts Man9GlcNAc to Man8GlcNAc isomer B. It is required for N-glycan trimming to Man5-6GlcNAc2 in the endoplasmic-reticulum-associated degradation pathway. Mutations in this gene cause autosomal-recessive intellectual disability. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Man1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Man1b1 APN 2 25343325 missense possibly damaging 0.53
IGL01338:Man1b1 APN 2 25338227 missense probably benign 0.01
IGL01934:Man1b1 APN 2 25345511 missense probably benign 0.00
IGL03063:Man1b1 APN 2 25334404 missense possibly damaging 0.48
IGL03067:Man1b1 APN 2 25349332 missense probably benign
canebrake UTSW 2 25343353 missense probably damaging 1.00
sugarcane UTSW 2 25343251 missense probably damaging 1.00
PIT4520001:Man1b1 UTSW 2 25343270 missense probably damaging 1.00
R0731:Man1b1 UTSW 2 25338155 missense possibly damaging 0.87
R1716:Man1b1 UTSW 2 25345020 missense probably benign 0.14
R4470:Man1b1 UTSW 2 25332855 intron probably benign
R4472:Man1b1 UTSW 2 25332855 intron probably benign
R4838:Man1b1 UTSW 2 25345475 missense possibly damaging 0.79
R4953:Man1b1 UTSW 2 25338184 missense probably damaging 0.99
R5861:Man1b1 UTSW 2 25348054 missense probably benign 0.01
R6608:Man1b1 UTSW 2 25343251 missense probably damaging 1.00
R7098:Man1b1 UTSW 2 25338184 missense probably damaging 0.99
R7215:Man1b1 UTSW 2 25350390 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGGGACTGTTCTTGCCAC -3'
(R):5'- CTAGATGAGAAACAGGCCCTG -3'

Sequencing Primer
(F):5'- GGACTGTTCTTGCCACTCATATTTTC -3'
(R):5'- AGCACACATTTTCCCATATCTAGG -3'
Posted On2016-06-21