Incidental Mutation 'R5866:Plxnb2'
ID454194
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock #R5866 (G1)
Quality Score82
Status Validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89167572 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 148 (D148G)
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect probably damaging
Transcript: ENSMUST00000060808
AA Change: D148G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: D148G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109331
AA Change: D148G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: D148G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197760
Meta Mutation Damage Score 0.494 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.7%
Validation Efficiency 91% (51/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,169,084 probably benign Het
A530084C06Rik G A 13: 31,559,195 A25V unknown Het
A730018C14Rik T C 12: 112,415,038 noncoding transcript Het
Aasdh G T 5: 76,876,211 A198E probably damaging Het
Abcb8 C T 5: 24,402,103 A328V probably damaging Het
Ace3 C A 11: 105,997,504 H347N probably damaging Het
Amy1 A T 3: 113,561,920 M302K possibly damaging Het
Apol11b C T 15: 77,640,547 V13M probably null Het
Arfgef2 T A 2: 166,836,257 V131E possibly damaging Het
Arnt T A 3: 95,490,726 probably benign Het
Atl1 T C 12: 69,926,011 V35A probably damaging Het
BC061237 A T 14: 44,501,273 D43V possibly damaging Het
C530008M17Rik A G 5: 76,857,537 T582A unknown Het
Cyp4f17 T C 17: 32,506,913 S7P probably benign Het
Ddx60 A G 8: 61,940,740 Y70C probably damaging Het
Defb34 T C 8: 19,126,452 L53P probably damaging Het
Dennd5a T C 7: 109,919,360 T525A probably benign Het
Ephb3 T C 16: 21,211,379 probably benign Het
Fam83d T A 2: 158,779,830 probably null Het
Gramd3 A G 18: 56,474,036 D74G possibly damaging Het
Hax1 A G 3: 89,995,728 probably benign Het
Kcnh8 T C 17: 52,956,776 I767T probably benign Het
Ldah G A 12: 8,220,614 V5I possibly damaging Het
Nbeal2 A G 9: 110,631,492 V1758A probably damaging Het
Nos1 A G 5: 117,895,902 D363G probably damaging Het
Olfr127 C T 17: 37,903,809 R88* probably null Het
Pdlim7 T A 13: 55,498,688 D445V probably damaging Het
Phip T A 9: 82,890,150 M1115L probably benign Het
Pigb C T 9: 73,029,684 A215T probably damaging Het
Pkd1 A T 17: 24,580,961 S2952C probably damaging Het
Ppp1r36 T C 12: 76,426,805 F70S possibly damaging Het
Rad52 G A 6: 119,912,946 probably benign Het
Rasa2 T A 9: 96,545,770 T681S probably benign Het
Rel A T 11: 23,742,724 Y436* probably null Het
Sec16a G A 2: 26,419,638 P2119S probably benign Het
Sema6d C A 2: 124,664,342 T733K probably benign Het
Sf3b3 C T 8: 110,814,634 A950T probably benign Het
Slc24a5 T A 2: 125,085,671 F297I probably damaging Het
Spp2 A T 1: 88,412,303 D122V possibly damaging Het
Stap1 A G 5: 86,078,047 K60R probably benign Het
Stat1 A G 1: 52,139,264 K286E probably damaging Het
Stn1 T C 19: 47,517,129 T129A probably benign Het
Tagap C T 17: 7,933,453 T490I probably damaging Het
Tbc1d2 T C 4: 46,637,715 E177G possibly damaging Het
Tln2 A T 9: 67,266,868 L841Q probably damaging Het
Tmem59 T A 4: 107,190,557 M71K probably damaging Het
Ugt2a3 G A 5: 87,336,547 T206I probably damaging Het
Utp20 G A 10: 88,772,559 H1539Y possibly damaging Het
Vps13a T C 19: 16,680,023 N1794S probably benign Het
Vsig10 A T 5: 117,352,749 probably null Het
Zfp97 T A 17: 17,144,825 F195L possibly damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AAAGGCTGCGACAAACTGC -3'
(R):5'- AAGCGGTGCTCACTGACAAC -3'

Sequencing Primer
(F):5'- CTGCGACAAACTGCTGAGTATTCG -3'
(R):5'- GGTGCTCACTGACAACTTCAAC -3'
Posted On2017-02-10