Incidental Mutation 'R5685:Plxnb2'
ID443314
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5685 (G1)
Quality Score216
Status Not validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89167032 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 328 (R328H)
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect probably damaging
Transcript: ENSMUST00000060808
AA Change: R328H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: R328H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109331
AA Change: R328H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: R328H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197760
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TAGGAGTCAGACCCTATCTTCC -3'
(R):5'- TAGAGATGGACCTGCAGTGTC -3'

Sequencing Primer
(F):5'- TATCTTCCACAACACGAATCTACTG -3'
(R):5'- ATGGACCTGCAGTGTCAGGATC -3'
Posted On2016-11-09