Incidental Mutation 'R0560:Bspry'
ID45824
Institutional Source Beutler Lab
Gene Symbol Bspry
Ensembl Gene ENSMUSG00000028392
Gene NameB-box and SPRY domain containing
Synonymszetin 1
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R0560 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62480053-62497298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62486449 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 161 (R161G)
Ref Sequence ENSEMBL: ENSMUSP00000103073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030088] [ENSMUST00000107449] [ENSMUST00000132237]
Predicted Effect probably damaging
Transcript: ENSMUST00000030088
AA Change: R161G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030088
Gene: ENSMUSG00000028392
AA Change: R161G

DomainStartEndE-ValueType
low complexity region 9 60 N/A INTRINSIC
Pfam:zf-B_box 65 107 1.2e-8 PFAM
low complexity region 225 239 N/A INTRINSIC
PRY 277 330 1.79e-15 SMART
Pfam:SPRY 333 451 3.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107449
AA Change: R161G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103073
Gene: ENSMUSG00000028392
AA Change: R161G

DomainStartEndE-ValueType
low complexity region 9 60 N/A INTRINSIC
Pfam:zf-B_box 65 107 4.4e-9 PFAM
low complexity region 225 239 N/A INTRINSIC
PRY 277 330 1.79e-15 SMART
Pfam:SPRY 331 452 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132237
SMART Domains Protein: ENSMUSP00000119504
Gene: ENSMUSG00000028392

DomainStartEndE-ValueType
low complexity region 9 60 N/A INTRINSIC
Pfam:zf-B_box 65 107 2e-9 PFAM
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Bspry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Bspry APN 4 62496105 missense probably benign 0.44
IGL02186:Bspry APN 4 62495989 splice site probably benign
IGL02501:Bspry APN 4 62496435 missense probably benign 0.04
IGL02644:Bspry APN 4 62496328 missense probably damaging 1.00
R0041:Bspry UTSW 4 62486554 missense probably damaging 1.00
R0306:Bspry UTSW 4 62496157 missense probably damaging 1.00
R1919:Bspry UTSW 4 62494797 missense probably damaging 1.00
R3038:Bspry UTSW 4 62496983 missense probably benign 0.36
R4431:Bspry UTSW 4 62482667 missense possibly damaging 0.95
R4690:Bspry UTSW 4 62486525 missense probably damaging 0.98
R4735:Bspry UTSW 4 62486525 missense probably damaging 0.98
R5432:Bspry UTSW 4 62482715 missense probably benign 0.01
R5684:Bspry UTSW 4 62496282 missense possibly damaging 0.81
R7209:Bspry UTSW 4 62486615 missense possibly damaging 0.86
X0025:Bspry UTSW 4 62480198 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCCTGACCACTGGGAGTTAGAAG -3'
(R):5'- TCATGTCCACCATGTTGGTGCG -3'

Sequencing Primer
(F):5'- ATGACCTTCTGAGACATGGC -3'
(R):5'- CATGTTGGTGCGGAGGG -3'
Posted On2013-06-11