Incidental Mutation 'R0560:Cyp2t4'
ID45829
Institutional Source Beutler Lab
Gene Symbol Cyp2t4
Ensembl Gene ENSMUSG00000078787
Gene Namecytochrome P450, family 2, subfamily t, polypeptide 4
SynonymsLOC384724
MMRRC Submission 038752-MU
Accession Numbers

Genbank: NM_001100184; MGI: 2686296

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0560 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27153714-27158668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27158511 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 479 (T479A)
Ref Sequence ENSEMBL: ENSMUSP00000104022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080058] [ENSMUST00000108382] [ENSMUST00000108385] [ENSMUST00000164093]
Predicted Effect probably benign
Transcript: ENSMUST00000080058
SMART Domains Protein: ENSMUSP00000078966
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108382
SMART Domains Protein: ENSMUSP00000104019
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108385
AA Change: T479A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104022
Gene: ENSMUSG00000078787
AA Change: T479A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 35 492 5.3e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152021
Predicted Effect probably damaging
Transcript: ENSMUST00000164093
AA Change: T487A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126779
Gene: ENSMUSG00000078787
AA Change: T487A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:p450 43 500 2.6e-130 PFAM
Meta Mutation Damage Score 0.0348 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Cyp2t4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2t4 APN 7 27155298 missense probably benign 0.00
IGL00706:Cyp2t4 APN 7 27155158 missense probably benign 0.01
IGL02926:Cyp2t4 APN 7 27157803 missense probably damaging 1.00
R0632:Cyp2t4 UTSW 7 27158246 missense possibly damaging 0.82
R0788:Cyp2t4 UTSW 7 27155163 missense probably null
R1353:Cyp2t4 UTSW 7 27156630 missense probably benign 0.03
R1652:Cyp2t4 UTSW 7 27157390 missense possibly damaging 0.48
R1838:Cyp2t4 UTSW 7 27158416 missense possibly damaging 0.92
R1997:Cyp2t4 UTSW 7 27157613 critical splice donor site probably null
R2136:Cyp2t4 UTSW 7 27158160 missense probably benign 0.32
R2963:Cyp2t4 UTSW 7 27155274 missense possibly damaging 0.86
R6239:Cyp2t4 UTSW 7 27157475 missense possibly damaging 0.73
R6634:Cyp2t4 UTSW 7 27155788 nonsense probably null
R7251:Cyp2t4 UTSW 7 27157719 missense possibly damaging 0.72
Z1088:Cyp2t4 UTSW 7 27157746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAACAACGATGCCTTCATGC -3'
(R):5'- TCAGAGCTGCACACACTTGTATTCC -3'

Sequencing Primer
(F):5'- TAGCACTGGGGGACTGG -3'
(R):5'- ACACACTTGTATTCCTCTCTGTAAAG -3'
Posted On2013-06-11