Incidental Mutation 'R0560:Bicd1'
ID45828
Institutional Source Beutler Lab
Gene Symbol Bicd1
Ensembl Gene ENSMUSG00000003452
Gene NameBICD cargo adaptor 1
SynonymsB830009D06Rik
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R0560 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location149408886-149563329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149511962 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 284 (K284E)
Ref Sequence ENSEMBL: ENSMUSP00000003544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000172926] [ENSMUST00000173408]
Predicted Effect probably benign
Transcript: ENSMUST00000003544
AA Change: K284E

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: K284E

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086829
AA Change: K284E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: K284E

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111513
AA Change: K284E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: K284E

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172926
SMART Domains Protein: ENSMUSP00000133986
Gene: ENSMUSG00000003452

DomainStartEndE-ValueType
Pfam:BicD 1 98 1.2e-69 PFAM
low complexity region 103 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173408
AA Change: K284E

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: K284E

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174886
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Bicd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Bicd1 APN 6 149550390 missense possibly damaging 0.72
IGL02489:Bicd1 APN 6 149513037 missense probably damaging 1.00
IGL02626:Bicd1 APN 6 149409556 missense probably damaging 1.00
IGL02966:Bicd1 APN 6 149483996 missense probably damaging 0.99
IGL03256:Bicd1 APN 6 149513585 missense probably benign
R0123:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0131:Bicd1 UTSW 6 149512947 missense probably damaging 0.99
R0134:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0225:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0267:Bicd1 UTSW 6 149517042 missense probably damaging 1.00
R0481:Bicd1 UTSW 6 149511891 missense possibly damaging 0.90
R0729:Bicd1 UTSW 6 149512914 missense probably damaging 0.97
R0784:Bicd1 UTSW 6 149513363 missense probably damaging 0.98
R1994:Bicd1 UTSW 6 149513552 missense probably benign 0.00
R2221:Bicd1 UTSW 6 149517005 missense probably damaging 0.98
R2762:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R3428:Bicd1 UTSW 6 149512902 missense probably damaging 1.00
R3805:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3806:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3807:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R4694:Bicd1 UTSW 6 149409553 missense probably damaging 1.00
R4822:Bicd1 UTSW 6 149519254 intron probably benign
R4835:Bicd1 UTSW 6 149484090 missense probably benign 0.00
R5157:Bicd1 UTSW 6 149520414 missense probably benign 0.09
R5527:Bicd1 UTSW 6 149494636 missense probably damaging 1.00
R5611:Bicd1 UTSW 6 149513456 nonsense probably null
R5643:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5644:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5788:Bicd1 UTSW 6 149484000 missense probably benign 0.39
R5898:Bicd1 UTSW 6 149513703 missense probably damaging 0.99
R6222:Bicd1 UTSW 6 149512965 missense probably damaging 1.00
R6227:Bicd1 UTSW 6 149513176 nonsense probably null
R6522:Bicd1 UTSW 6 149484005 missense probably benign
R6781:Bicd1 UTSW 6 149513166 missense possibly damaging 0.86
R6812:Bicd1 UTSW 6 149409537 missense probably damaging 1.00
R7010:Bicd1 UTSW 6 149494615 missense probably damaging 1.00
R7203:Bicd1 UTSW 6 149512905 missense possibly damaging 0.91
R7265:Bicd1 UTSW 6 149513876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAGAAGCCCTTGAGACACTGA -3'
(R):5'- ACATGTTCTCCCCTTTGTGTGTCAAAA -3'

Sequencing Primer
(F):5'- GCCCTTGAGACACTGAAGAATG -3'
(R):5'- CCTTTGTGTGTCAAAAATCCCATAAC -3'
Posted On2013-06-11