Incidental Mutation 'R0560:Asb18'
ID45814
Institutional Source Beutler Lab
Gene Symbol Asb18
Ensembl Gene ENSMUSG00000067081
Gene Nameankyrin repeat and SOCS box-containing 18
Synonyms
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0560 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location89950220-90014666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 90014528 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 17 (V17G)
Ref Sequence ENSEMBL: ENSMUSP00000117767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086882] [ENSMUST00000097656] [ENSMUST00000151330] [ENSMUST00000154228]
Predicted Effect probably damaging
Transcript: ENSMUST00000086882
AA Change: V17G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084095
Gene: ENSMUSG00000067081
AA Change: V17G

DomainStartEndE-ValueType
Blast:ANK 15 44 3e-8 BLAST
ANK 119 148 5.32e-5 SMART
ANK 151 180 1.99e-4 SMART
ANK 184 213 3.26e2 SMART
ANK 218 247 3.95e1 SMART
ANK 251 289 1.96e3 SMART
ANK 293 322 6.61e-1 SMART
Blast:ANK 329 365 1e-12 BLAST
SOCS_box 422 461 4.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097656
AA Change: V17G

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095261
Gene: ENSMUSG00000067081
AA Change: V17G

DomainStartEndE-ValueType
Blast:ANK 15 44 1e-8 BLAST
SOCS_box 158 197 4.5e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151330
AA Change: V17G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117836
Gene: ENSMUSG00000067081
AA Change: V17G

DomainStartEndE-ValueType
Blast:ANK 15 44 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000154228
AA Change: V17G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117767
Gene: ENSMUSG00000067081
AA Change: V17G

DomainStartEndE-ValueType
Blast:ANK 15 44 9e-9 BLAST
ANK 78 107 5.32e-5 SMART
ANK 110 139 1.99e-4 SMART
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Asb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Asb18 APN 1 89996241 missense probably benign 0.02
IGL01559:Asb18 APN 1 89954450 missense probably damaging 1.00
IGL02188:Asb18 APN 1 89996299 missense probably benign 0.08
IGL02378:Asb18 APN 1 89992988 missense probably damaging 1.00
IGL02543:Asb18 APN 1 90014391 missense probably damaging 0.99
IGL02828:Asb18 APN 1 89996210 critical splice donor site probably null
IGL02877:Asb18 APN 1 89952811 missense possibly damaging 0.65
IGL03290:Asb18 APN 1 90014574 missense probably damaging 1.00
R0671:Asb18 UTSW 1 89993171 missense probably damaging 1.00
R1468:Asb18 UTSW 1 89996283 missense probably damaging 1.00
R1468:Asb18 UTSW 1 89996283 missense probably damaging 1.00
R1510:Asb18 UTSW 1 89996254 missense possibly damaging 0.62
R1721:Asb18 UTSW 1 89968580 missense probably benign 0.36
R1793:Asb18 UTSW 1 90014555 missense probably damaging 1.00
R1863:Asb18 UTSW 1 90014382 missense probably benign 0.10
R2171:Asb18 UTSW 1 89968697 missense probably benign 0.01
R2348:Asb18 UTSW 1 90014534 missense probably damaging 0.99
R3052:Asb18 UTSW 1 89992985 missense probably damaging 1.00
R3053:Asb18 UTSW 1 89992985 missense probably damaging 1.00
R3427:Asb18 UTSW 1 89968593 missense probably damaging 0.99
R4094:Asb18 UTSW 1 90014425 missense probably damaging 1.00
R4105:Asb18 UTSW 1 89968521 missense possibly damaging 0.61
R4405:Asb18 UTSW 1 89968689 missense probably benign 0.00
R4815:Asb18 UTSW 1 90014425 missense probably damaging 1.00
R4992:Asb18 UTSW 1 89952863 missense probably benign 0.03
R5287:Asb18 UTSW 1 90014388 missense probably benign 0.01
R5403:Asb18 UTSW 1 90014388 missense probably benign 0.01
R5494:Asb18 UTSW 1 89954399 missense probably damaging 1.00
R5504:Asb18 UTSW 1 89993024 missense probably damaging 1.00
R5617:Asb18 UTSW 1 89954462 missense possibly damaging 0.90
R5826:Asb18 UTSW 1 90014538 missense probably damaging 0.97
R6369:Asb18 UTSW 1 90014471 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCAACACAGTGTCTACCTGC -3'
(R):5'- TCTGCAAATACACAGAATGGGCCAG -3'

Sequencing Primer
(F):5'- AACAAGGGTATGTCACCCTGTTG -3'
(R):5'- TGAAAGCAGCGTGTCCCTC -3'
Posted On2013-06-11