Incidental Mutation 'R0505:Csmd1'
ID47476
Institutional Source Beutler Lab
Gene Symbol Csmd1
Ensembl Gene ENSMUSG00000060924
Gene NameCUB and Sushi multiple domains 1
Synonyms
MMRRC Submission 038700-MU
Accession Numbers

Genbank: NM_053171.2

Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R0505 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location15892537-17535586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15992758 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 2325 (R2325Q)
Ref Sequence ENSEMBL: ENSMUSP00000080751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082104]
Predicted Effect probably damaging
Transcript: ENSMUST00000082104
AA Change: R2325Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924
AA Change: R2325Q

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CUB 32 140 1.46e-26 SMART
CCP 145 202 1.01e-11 SMART
CUB 208 312 1.05e-27 SMART
CCP 349 406 1.28e-8 SMART
CUB 411 522 2.34e-25 SMART
CCP 527 580 1.22e-14 SMART
CUB 584 692 1.61e-37 SMART
CCP 697 754 4.41e-12 SMART
CUB 758 866 6.55e-38 SMART
CCP 873 926 2.53e-12 SMART
CUB 930 1040 8.94e-22 SMART
CCP 1045 1100 7.06e-11 SMART
CUB 1104 1212 3.14e-26 SMART
CCP 1217 1273 1.18e-12 SMART
CUB 1277 1386 9.72e-32 SMART
CCP 1391 1447 2.06e-12 SMART
CUB 1451 1559 1.68e-35 SMART
CCP 1564 1621 2.53e-12 SMART
CUB 1625 1733 4.24e-14 SMART
CCP 1741 1798 9.46e-12 SMART
CUB 1802 1910 4.23e-32 SMART
CCP 1915 1970 8.23e-12 SMART
CUB 1974 2082 8.59e-33 SMART
CCP 2087 2142 6.09e-15 SMART
CUB 2146 2253 2.36e-30 SMART
CCP 2258 2315 1.1e-12 SMART
CUB 2320 2430 4.3e-24 SMART
CCP 2432 2490 2.94e-8 SMART
CCP 2495 2552 2.03e-11 SMART
CCP 2557 2617 1.22e-5 SMART
CCP 2622 2675 2.72e-12 SMART
CCP 2680 2733 5.86e-17 SMART
CCP 2738 2791 6.09e-15 SMART
CCP 2796 2854 9.1e-14 SMART
CCP 2859 2912 3.96e-14 SMART
CCP 2920 2973 4.41e-12 SMART
CCP 2978 3032 2.94e-8 SMART
CCP 3037 3092 6.59e-11 SMART
CCP 3097 3150 4.12e-12 SMART
CCP 3155 3208 7.92e-14 SMART
CCP 3216 3270 2.8e-14 SMART
CCP 3275 3330 3.78e-11 SMART
transmembrane domain 3487 3509 N/A INTRINSIC
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (119/121)
MGI Phenotype PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,291,058 Y974H probably benign Het
Abca2 G T 2: 25,434,894 G300V probably benign Het
Abi1 A G 2: 22,962,504 probably benign Het
Actr10 T A 12: 70,959,964 Y332N probably damaging Het
Adam25 G T 8: 40,755,224 C509F probably damaging Het
Adck1 A T 12: 88,371,691 probably benign Het
Adgra3 A G 5: 50,009,334 probably null Het
Adgrl1 G T 8: 83,934,650 probably benign Het
Akr1c21 A G 13: 4,576,307 Y110C probably damaging Het
Arhgef25 T C 10: 127,183,697 I463V probably null Het
Atp6v1e2 C T 17: 86,944,578 V131M probably benign Het
Bdnf A G 2: 109,675,343 probably null Het
C7 A T 15: 4,994,142 probably benign Het
Cdc27 T C 11: 104,528,288 T273A probably benign Het
Cdo1 T A 18: 46,715,611 I187F probably benign Het
Cep104 A T 4: 153,996,304 T742S probably benign Het
Ckm A T 7: 19,419,452 K223* probably null Het
Cmtr1 C T 17: 29,676,285 P586L probably benign Het
Dcpp1 A T 17: 23,882,594 I106L possibly damaging Het
Diaph3 A C 14: 87,090,964 probably benign Het
Dnah11 A G 12: 118,106,510 V1520A probably damaging Het
Dnajc25 T A 4: 59,020,438 M168K possibly damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Ebf2 A T 14: 67,371,736 K199* probably null Het
Efcab11 T A 12: 99,719,035 Q160L probably benign Het
Eif2ak4 T A 2: 118,431,036 S686T probably benign Het
Epha6 C T 16: 60,205,732 S449N possibly damaging Het
Ercc4 T C 16: 13,126,467 V329A probably benign Het
Faf1 T C 4: 109,840,403 F309L possibly damaging Het
Fam102b T C 3: 108,980,204 E248G probably benign Het
G6pd2 C A 5: 61,809,567 D228E probably benign Het
Ggt1 T G 10: 75,585,957 V546G probably damaging Het
Gm14139 T A 2: 150,193,080 C471* probably null Het
Gpatch4 G T 3: 88,051,217 V3F probably damaging Het
Gprin3 A G 6: 59,353,387 L645P probably damaging Het
Hyal2 A G 9: 107,572,071 Y342C probably benign Het
Igf2bp2 A G 16: 22,089,099 I16T possibly damaging Het
Inca1 T C 11: 70,690,199 Y61C probably damaging Het
Ipo5 T C 14: 120,942,733 W860R possibly damaging Het
Kcnj9 C T 1: 172,323,024 A341T probably benign Het
Kdm5b T C 1: 134,602,571 V440A probably damaging Het
L3mbtl1 C T 2: 162,947,335 probably benign Het
Lin54 G A 5: 100,452,293 T307I probably damaging Het
Lrrc18 C A 14: 33,009,139 Q212K probably benign Het
Lrrc37a A G 11: 103,503,025 S525P probably benign Het
Lrrc71 T A 3: 87,745,699 S137C probably damaging Het
Lrrk1 A T 7: 66,290,908 probably null Het
Man2b2 G A 5: 36,816,198 S58L probably benign Het
Masp1 T A 16: 23,458,138 H539L probably benign Het
Med1 G A 11: 98,156,904 P1022L probably damaging Het
Meis1 T A 11: 19,011,360 H171L probably damaging Het
Mier1 T A 4: 103,155,623 probably benign Het
Mkl2 C T 16: 13,412,526 T1025I possibly damaging Het
Mmp13 A T 9: 7,272,929 R96S probably damaging Het
Mms19 G A 19: 41,953,734 T38I probably damaging Het
Mrc1 G A 2: 14,310,032 C976Y probably damaging Het
Naalad2 A G 9: 18,385,895 Y32H probably benign Het
Ndufs1 A G 1: 63,143,926 probably benign Het
Nefm C T 14: 68,124,159 D219N probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Nwd2 T A 5: 63,805,111 D679E probably damaging Het
Ogdh T A 11: 6,339,936 probably benign Het
Olfm3 T A 3: 115,122,681 S421T possibly damaging Het
Olfr1281 A T 2: 111,329,328 N303I probably benign Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr559 T A 7: 102,724,029 I154F probably damaging Het
Olfr628 T C 7: 103,732,376 V150A probably benign Het
Olfr988 A G 2: 85,353,749 M59T possibly damaging Het
Opn5 T G 17: 42,592,953 T164P possibly damaging Het
Pde7b C T 10: 20,438,746 V166M probably damaging Het
Pik3ap1 T C 19: 41,324,564 N370S probably damaging Het
Pkhd1l1 A T 15: 44,589,418 D3913V probably damaging Het
Pld1 A G 3: 28,120,822 I90V possibly damaging Het
Plxna2 A G 1: 194,644,348 T197A possibly damaging Het
Plxna4 A T 6: 32,202,119 M987K probably benign Het
Pmch A G 10: 88,091,359 N75D probably benign Het
Prom2 T A 2: 127,532,867 Q583L possibly damaging Het
Pyroxd1 T A 6: 142,353,562 M148K possibly damaging Het
R3hdm2 C T 10: 127,457,700 L158F probably damaging Het
Rapgef6 A T 11: 54,625,963 T349S probably benign Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rif1 C A 2: 52,110,737 P1401Q probably damaging Het
Robo3 G A 9: 37,416,759 probably benign Het
Rpn1 T A 6: 88,090,242 S195T probably benign Het
Rslcan18 C A 13: 67,102,119 K17N probably benign Het
Rsph3b A T 17: 6,941,727 I48N probably damaging Het
Sbf2 A T 7: 110,399,343 Y628N probably damaging Het
Sis T C 3: 72,960,296 T139A probably benign Het
Slc22a14 A G 9: 119,172,034 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Smarcb1 T C 10: 75,897,066 T372A probably damaging Het
Spidr T A 16: 16,037,667 H328L probably damaging Het
Sun5 T A 2: 153,870,952 D16V probably damaging Het
Syde2 G A 3: 146,014,380 E1053K possibly damaging Het
Syne2 T C 12: 76,099,464 S6419P probably damaging Het
Tenm3 G A 8: 48,341,160 probably benign Het
Timm44 C A 8: 4,260,532 E407* probably null Het
Tmem189 A T 2: 167,644,987 probably benign Het
Tnpo2 A G 8: 85,047,362 T342A probably benign Het
Trio A G 15: 27,767,907 C1964R probably benign Het
Trip11 A C 12: 101,885,672 L711R probably damaging Het
Trp53bp1 A T 2: 121,269,969 H101Q probably damaging Het
Trpm6 A G 19: 18,873,902 probably benign Het
Ttn A T 2: 76,849,991 probably benign Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Uhrf1bp1l T C 10: 89,791,443 S145P probably damaging Het
Unc5a T A 13: 55,004,954 S838T probably damaging Het
Uxs1 T C 1: 43,764,886 probably null Het
Vmn2r108 A T 17: 20,462,834 C703S possibly damaging Het
Zc3hav1 C T 6: 38,332,664 G408R probably damaging Het
Zfp609 G A 9: 65,703,462 L740F possibly damaging Het
Zfp69 T C 4: 120,931,095 E341G probably damaging Het
Zfp707 A T 15: 75,975,256 H312L probably damaging Het
Zfp773 T C 7: 7,133,024 D191G probably benign Het
Zgrf1 C A 3: 127,573,238 D755E probably benign Het
Zscan5b T A 7: 6,239,075 I431N probably damaging Het
Other mutations in Csmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Csmd1 APN 8 16009297 splice site probably benign
IGL00433:Csmd1 APN 8 16231373 missense probably damaging 1.00
IGL00500:Csmd1 APN 8 15921139 missense probably damaging 1.00
IGL00666:Csmd1 APN 8 16189990 missense probably damaging 1.00
IGL00913:Csmd1 APN 8 16071287 missense probably benign 0.00
IGL01012:Csmd1 APN 8 15917341 missense probably benign 0.00
IGL01123:Csmd1 APN 8 17534928 missense possibly damaging 0.96
IGL01348:Csmd1 APN 8 15910596 missense probably damaging 0.99
IGL01444:Csmd1 APN 8 16200055 missense probably benign 0.00
IGL01530:Csmd1 APN 8 15903195 missense probably damaging 0.99
IGL01548:Csmd1 APN 8 16288646 nonsense probably null
IGL01814:Csmd1 APN 8 16501375 missense probably damaging 1.00
IGL01889:Csmd1 APN 8 15998857 missense probably damaging 1.00
IGL02055:Csmd1 APN 8 16069001 missense probably damaging 0.99
IGL02066:Csmd1 APN 8 15926594 missense probably damaging 1.00
IGL02097:Csmd1 APN 8 16211759 missense probably null 0.17
IGL02112:Csmd1 APN 8 16081705 missense probably benign 0.18
IGL02161:Csmd1 APN 8 16358412 missense probably damaging 0.97
IGL02189:Csmd1 APN 8 16271606 missense probably damaging 0.99
IGL02272:Csmd1 APN 8 16199893 missense probably damaging 0.99
IGL02292:Csmd1 APN 8 16211870 missense probably damaging 1.00
IGL02385:Csmd1 APN 8 15903275 missense probably benign 0.08
IGL02424:Csmd1 APN 8 16092326 missense probably benign 0.22
IGL02492:Csmd1 APN 8 16002597 missense probably benign 0.13
IGL02507:Csmd1 APN 8 17534976 utr 5 prime probably benign
IGL02513:Csmd1 APN 8 15999869 splice site probably benign
IGL02727:Csmd1 APN 8 16231327 missense probably damaging 1.00
IGL02728:Csmd1 APN 8 15999779 critical splice donor site probably null
IGL02852:Csmd1 APN 8 15895728 missense probably damaging 0.99
IGL02935:Csmd1 APN 8 16223334 missense probably damaging 1.00
IGL02945:Csmd1 APN 8 16271570 missense possibly damaging 0.92
IGL02959:Csmd1 APN 8 15910465 missense probably damaging 0.99
IGL03113:Csmd1 APN 8 16028698 missense probably benign
IGL03129:Csmd1 APN 8 15961521 missense probably damaging 0.99
IGL03131:Csmd1 APN 8 16088217 missense probably damaging 1.00
IGL03275:Csmd1 APN 8 16157092 missense probably benign 0.00
IGL03297:Csmd1 APN 8 16009432 nonsense probably null
I2289:Csmd1 UTSW 8 15912381 missense probably benign 0.10
IGL03055:Csmd1 UTSW 8 16095501 missense probably damaging 1.00
IGL03097:Csmd1 UTSW 8 15945127 missense probably damaging 1.00
R0037:Csmd1 UTSW 8 15917248 missense probably damaging 0.97
R0095:Csmd1 UTSW 8 16233051 missense probably damaging 1.00
R0113:Csmd1 UTSW 8 15984849 missense probably damaging 1.00
R0129:Csmd1 UTSW 8 16079942 missense possibly damaging 0.95
R0144:Csmd1 UTSW 8 16391824 missense probably benign 0.16
R0166:Csmd1 UTSW 8 16233022 missense probably benign 0.29
R0227:Csmd1 UTSW 8 16391822 missense probably benign 0.05
R0279:Csmd1 UTSW 8 16223235 missense probably damaging 0.99
R0280:Csmd1 UTSW 8 16271602 missense probably damaging 1.00
R0312:Csmd1 UTSW 8 15984760 missense probably damaging 1.00
R0355:Csmd1 UTSW 8 15918330 missense probably damaging 0.97
R0367:Csmd1 UTSW 8 15917270 missense probably damaging 1.00
R0395:Csmd1 UTSW 8 16346638 missense probably damaging 0.99
R0413:Csmd1 UTSW 8 16710514 missense probably damaging 0.97
R0457:Csmd1 UTSW 8 16501393 critical splice acceptor site probably null
R0463:Csmd1 UTSW 8 15921759 missense probably damaging 0.99
R0482:Csmd1 UTSW 8 16233101 missense probably damaging 1.00
R0501:Csmd1 UTSW 8 17027323 missense probably damaging 0.97
R0507:Csmd1 UTSW 8 16185344 splice site probably benign
R0511:Csmd1 UTSW 8 15932529 missense possibly damaging 0.80
R0555:Csmd1 UTSW 8 16185273 missense probably benign
R0580:Csmd1 UTSW 8 15910528 missense probably damaging 1.00
R0610:Csmd1 UTSW 8 15918208 missense possibly damaging 0.95
R0634:Csmd1 UTSW 8 16226391 missense probably damaging 1.00
R0666:Csmd1 UTSW 8 16069049 missense possibly damaging 0.88
R0674:Csmd1 UTSW 8 16000550 missense probably benign 0.03
R0675:Csmd1 UTSW 8 16158131 missense probably benign 0.01
R0763:Csmd1 UTSW 8 17027284 missense possibly damaging 0.67
R0781:Csmd1 UTSW 8 15921174 missense probably benign 0.35
R0862:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0864:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0925:Csmd1 UTSW 8 16710618 missense probably benign 0.29
R0926:Csmd1 UTSW 8 16033576 splice site probably null
R1005:Csmd1 UTSW 8 16288693 missense probably damaging 0.99
R1073:Csmd1 UTSW 8 16358463 splice site probably benign
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1256:Csmd1 UTSW 8 16079964 missense probably damaging 1.00
R1294:Csmd1 UTSW 8 16698036 missense probably damaging 0.99
R1375:Csmd1 UTSW 8 16463081 splice site probably null
R1447:Csmd1 UTSW 8 15925306 nonsense probably null
R1450:Csmd1 UTSW 8 15945180 critical splice acceptor site probably null
R1470:Csmd1 UTSW 8 16157204 splice site probably benign
R1580:Csmd1 UTSW 8 15925299 missense probably damaging 1.00
R1591:Csmd1 UTSW 8 15900710 missense probably damaging 0.99
R1658:Csmd1 UTSW 8 16081725 missense possibly damaging 0.69
R1678:Csmd1 UTSW 8 15918252 missense possibly damaging 0.58
R1717:Csmd1 UTSW 8 17216692 missense possibly damaging 0.58
R1735:Csmd1 UTSW 8 15932610 missense probably damaging 0.99
R1750:Csmd1 UTSW 8 15917303 missense probably damaging 0.99
R1753:Csmd1 UTSW 8 16157120 nonsense probably null
R1822:Csmd1 UTSW 8 16223326 missense probably damaging 1.00
R1875:Csmd1 UTSW 8 15929101 missense probably damaging 0.99
R1909:Csmd1 UTSW 8 15906116 missense probably damaging 1.00
R1912:Csmd1 UTSW 8 16233998 critical splice donor site probably null
R1993:Csmd1 UTSW 8 16346684 missense probably damaging 0.99
R2067:Csmd1 UTSW 8 15900782 missense probably benign
R2094:Csmd1 UTSW 8 16079978 missense probably damaging 0.99
R2119:Csmd1 UTSW 8 17216733 missense probably damaging 0.98
R2127:Csmd1 UTSW 8 15917392 missense probably damaging 1.00
R2138:Csmd1 UTSW 8 15929088 missense probably damaging 0.96
R2216:Csmd1 UTSW 8 17027339 critical splice acceptor site probably null
R2220:Csmd1 UTSW 8 15992641 missense possibly damaging 0.94
R2380:Csmd1 UTSW 8 16190087 missense probably damaging 1.00
R2471:Csmd1 UTSW 8 16211762 missense probably damaging 1.00
R2984:Csmd1 UTSW 8 15953782 missense probably damaging 1.00
R3001:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3002:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3003:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3103:Csmd1 UTSW 8 15917405 missense probably damaging 1.00
R3104:Csmd1 UTSW 8 17027231 missense probably damaging 1.00
R3620:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3621:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3748:Csmd1 UTSW 8 15906071 missense probably damaging 0.99
R3780:Csmd1 UTSW 8 16201986 missense probably damaging 1.00
R3815:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3816:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3818:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3819:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3850:Csmd1 UTSW 8 16079922 missense probably benign 0.00
R3945:Csmd1 UTSW 8 15910619 intron probably null
R3980:Csmd1 UTSW 8 15906056 nonsense probably null
R4061:Csmd1 UTSW 8 15945158 missense probably benign 0.00
R4086:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4087:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4089:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4183:Csmd1 UTSW 8 15910464 missense probably damaging 0.99
R4226:Csmd1 UTSW 8 16000490 missense probably damaging 0.99
R4454:Csmd1 UTSW 8 15945011 missense probably damaging 0.99
R4533:Csmd1 UTSW 8 15931037 splice site probably null
R4544:Csmd1 UTSW 8 16710636 missense possibly damaging 0.93
R4547:Csmd1 UTSW 8 16391797 missense possibly damaging 0.48
R4612:Csmd1 UTSW 8 15921908 splice site probably null
R4620:Csmd1 UTSW 8 16002694 critical splice acceptor site probably null
R4627:Csmd1 UTSW 8 16697917 missense probably benign 0.00
R4633:Csmd1 UTSW 8 16002620 missense probably damaging 0.99
R4646:Csmd1 UTSW 8 15932511 missense possibly damaging 0.87
R4648:Csmd1 UTSW 8 15998788 nonsense probably null
R4668:Csmd1 UTSW 8 16023891 missense possibly damaging 0.50
R4709:Csmd1 UTSW 8 16023891 missense possibly damaging 0.96
R4709:Csmd1 UTSW 8 16710506 critical splice donor site probably null
R4741:Csmd1 UTSW 8 15910447 missense probably damaging 0.99
R4774:Csmd1 UTSW 8 16009369 missense probably benign 0.11
R4793:Csmd1 UTSW 8 16088263 missense probably damaging 1.00
R4829:Csmd1 UTSW 8 16127296 missense probably damaging 1.00
R4888:Csmd1 UTSW 8 15895674 utr 3 prime probably benign
R4896:Csmd1 UTSW 8 16009439 missense probably benign 0.00
R4932:Csmd1 UTSW 8 16023765 missense probably damaging 0.99
R4944:Csmd1 UTSW 8 15998772 missense probably damaging 1.00
R4953:Csmd1 UTSW 8 16199917 missense probably damaging 0.99
R4996:Csmd1 UTSW 8 15910452 missense probably damaging 0.97
R5028:Csmd1 UTSW 8 15989090 missense probably damaging 1.00
R5146:Csmd1 UTSW 8 16196190 missense probably damaging 1.00
R5272:Csmd1 UTSW 8 16199944 missense probably damaging 0.99
R5327:Csmd1 UTSW 8 17216712 missense possibly damaging 0.94
R5399:Csmd1 UTSW 8 16710597 missense probably damaging 1.00
R5411:Csmd1 UTSW 8 15910471 missense probably damaging 1.00
R5462:Csmd1 UTSW 8 15961486 missense probably benign 0.12
R5463:Csmd1 UTSW 8 15984860 missense probably benign 0.34
R5497:Csmd1 UTSW 8 16085181 missense probably benign 0.20
R5536:Csmd1 UTSW 8 16288660 missense probably damaging 0.99
R5711:Csmd1 UTSW 8 15953703 missense probably damaging 1.00
R5730:Csmd1 UTSW 8 16185192 nonsense probably null
R5788:Csmd1 UTSW 8 16201966 missense probably damaging 1.00
R5941:Csmd1 UTSW 8 15932471 missense probably damaging 0.99
R5960:Csmd1 UTSW 8 16071416 missense possibly damaging 0.68
R5961:Csmd1 UTSW 8 16070352 missense probably damaging 0.99
R5969:Csmd1 UTSW 8 16071353 missense probably benign 0.00
R5998:Csmd1 UTSW 8 15910443 missense probably damaging 1.00
R6062:Csmd1 UTSW 8 16092305 missense possibly damaging 0.68
R6109:Csmd1 UTSW 8 16199860 missense possibly damaging 0.93
R6116:Csmd1 UTSW 8 16211850 missense probably damaging 1.00
R6143:Csmd1 UTSW 8 16088301 missense probably damaging 1.00
R6155:Csmd1 UTSW 8 15903231 missense probably benign 0.01
R6197:Csmd1 UTSW 8 15926611 missense probably benign 0.32
R6247:Csmd1 UTSW 8 16196235 missense possibly damaging 0.91
R6304:Csmd1 UTSW 8 16058674 missense probably damaging 1.00
R6317:Csmd1 UTSW 8 16710642 missense possibly damaging 0.89
R6318:Csmd1 UTSW 8 15903212 missense probably damaging 1.00
R6338:Csmd1 UTSW 8 15932492 missense possibly damaging 0.75
R6369:Csmd1 UTSW 8 17535004 start gained probably benign
R6447:Csmd1 UTSW 8 15910527 missense probably damaging 1.00
R6454:Csmd1 UTSW 8 15921150 missense probably damaging 0.99
R6494:Csmd1 UTSW 8 16211695 splice site probably null
R6614:Csmd1 UTSW 8 17216787 missense probably damaging 1.00
R6736:Csmd1 UTSW 8 16002626 missense probably damaging 0.99
R6769:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6771:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6804:Csmd1 UTSW 8 16037246 missense probably damaging 1.00
R6818:Csmd1 UTSW 8 16185327 missense probably damaging 1.00
R6863:Csmd1 UTSW 8 17534913 missense possibly damaging 0.85
R6930:Csmd1 UTSW 8 16092395 missense probably damaging 0.97
R6969:Csmd1 UTSW 8 17216789 missense possibly damaging 0.94
X0011:Csmd1 UTSW 8 16196263 missense probably damaging 1.00
X0021:Csmd1 UTSW 8 16185256 missense probably damaging 1.00
X0024:Csmd1 UTSW 8 16037218 missense probably damaging 0.99
X0028:Csmd1 UTSW 8 15915333 missense possibly damaging 0.79
Z1088:Csmd1 UTSW 8 15921875 missense possibly damaging 0.91
Z1088:Csmd1 UTSW 8 16092258 missense probably damaging 1.00
Z1088:Csmd1 UTSW 8 16189978 missense possibly damaging 0.50
Z1088:Csmd1 UTSW 8 16200058 missense probably damaging 0.97
Z1088:Csmd1 UTSW 8 16346617 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGGCTTACCATCAAACACTTCCAG -3'
(R):5'- ACCAATCCTGCTGAAAACTGTGGC -3'

Sequencing Primer
(F):5'- ACTTCCAGTGCATCAAATTGC -3'
(R):5'- CAAACAGTGCAGGTGTGTGTG -3'
Posted On2013-06-12