Incidental Mutation 'R6034:Olfr1303'
ID480547
Institutional Source Beutler Lab
Gene Symbol Olfr1303
Ensembl Gene ENSMUSG00000093804
Gene Nameolfactory receptor 1303
SynonymsMOR245-7, MOR245-7, Olfr276, GA_x6K02T2N82Q-3465-3764, GA_x6K02T2Q125-72882187-72881249, MOR245-28_p
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111812247-111820340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111814357 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 123 (Y123F)
Ref Sequence ENSEMBL: ENSMUSP00000149015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099609] [ENSMUST00000216114]
Predicted Effect probably damaging
Transcript: ENSMUST00000099609
AA Change: Y123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097204
Gene: ENSMUSG00000093804
AA Change: Y123F

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 2.3e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 302 2.5e-6 PFAM
Pfam:7tm_1 41 287 2.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216114
AA Change: Y123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Olfr1303
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr1303 APN 2 111813781 utr 3 prime probably benign
IGL02442:Olfr1303 APN 2 111813991 missense probably benign 0.26
IGL02563:Olfr1303 APN 2 111813817 missense probably benign
IGL03064:Olfr1303 APN 2 111814423 missense possibly damaging 0.86
R0081:Olfr1303 UTSW 2 111813868 missense probably damaging 1.00
R0139:Olfr1303 UTSW 2 111814354 missense possibly damaging 0.54
R0624:Olfr1303 UTSW 2 111814711 missense probably damaging 1.00
R0926:Olfr1303 UTSW 2 111814547 missense probably damaging 1.00
R1436:Olfr1303 UTSW 2 111814561 missense probably damaging 1.00
R2099:Olfr1303 UTSW 2 111813832 missense probably benign 0.18
R5255:Olfr1303 UTSW 2 111814178 missense probably benign 0.02
R6034:Olfr1303 UTSW 2 111814357 missense probably damaging 1.00
R6101:Olfr1303 UTSW 2 111814253 missense probably benign 0.00
R6385:Olfr1303 UTSW 2 111814619 missense probably benign
R6489:Olfr1303 UTSW 2 111814060 missense probably damaging 1.00
R6978:Olfr1303 UTSW 2 111813810 missense probably benign 0.03
Predicted Primers
Posted On2017-06-26