Incidental Mutation 'R6034:Hmgxb3'
ID480586
Institutional Source Beutler Lab
Gene Symbol Hmgxb3
Ensembl Gene ENSMUSG00000024622
Gene NameHMG box domain containing 3
Synonyms2510002C16Rik, A630042L21Rik
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location61131279-61177050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61132522 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1128 (H1128L)
Ref Sequence ENSEMBL: ENSMUSP00000089498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025523] [ENSMUST00000091884] [ENSMUST00000115268]
Predicted Effect probably benign
Transcript: ENSMUST00000025523
SMART Domains Protein: ENSMUSP00000025523
Gene: ENSMUSG00000024621

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091884
AA Change: H1128L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089498
Gene: ENSMUSG00000024622
AA Change: H1128L

DomainStartEndE-ValueType
HMG 40 110 6.8e-15 SMART
low complexity region 182 194 N/A INTRINSIC
internal_repeat_1 307 336 1.98e-9 PROSPERO
internal_repeat_1 583 612 1.98e-9 PROSPERO
low complexity region 817 830 N/A INTRINSIC
low complexity region 966 977 N/A INTRINSIC
low complexity region 1239 1254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115268
SMART Domains Protein: ENSMUSP00000110923
Gene: ENSMUSG00000024621

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of the non-canonical high mobility group (HMG) genes. The encoded protein contains an HMG-box domain found in DNA binding proteins such as transcription factors and chromosomal proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Hmgxb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Hmgxb3 APN 18 61157739 missense probably benign 0.00
IGL01325:Hmgxb3 APN 18 61134006 missense probably damaging 1.00
IGL01364:Hmgxb3 APN 18 61146434 missense probably damaging 0.96
IGL02160:Hmgxb3 APN 18 61171236 missense probably damaging 1.00
IGL02271:Hmgxb3 APN 18 61132213 missense probably damaging 1.00
IGL02755:Hmgxb3 APN 18 61172188 missense probably damaging 1.00
R0309:Hmgxb3 UTSW 18 61155128 splice site probably benign
R0828:Hmgxb3 UTSW 18 61171354 missense probably damaging 1.00
R1276:Hmgxb3 UTSW 18 61165504 missense probably benign 0.04
R1429:Hmgxb3 UTSW 18 61150433 missense probably damaging 0.98
R1491:Hmgxb3 UTSW 18 61133908 missense probably benign 0.04
R1675:Hmgxb3 UTSW 18 61135559 missense probably damaging 1.00
R1886:Hmgxb3 UTSW 18 61137401 critical splice donor site probably null
R1887:Hmgxb3 UTSW 18 61137401 critical splice donor site probably null
R2070:Hmgxb3 UTSW 18 61171359 missense probably damaging 1.00
R2084:Hmgxb3 UTSW 18 61155023 splice site probably benign
R2110:Hmgxb3 UTSW 18 61155386 missense possibly damaging 0.54
R2112:Hmgxb3 UTSW 18 61155386 missense possibly damaging 0.54
R2149:Hmgxb3 UTSW 18 61157674 missense probably benign 0.08
R2342:Hmgxb3 UTSW 18 61162991 missense possibly damaging 0.89
R2436:Hmgxb3 UTSW 18 61147494 missense probably benign
R2898:Hmgxb3 UTSW 18 61155296 missense probably benign 0.00
R2975:Hmgxb3 UTSW 18 61162966 nonsense probably null
R3110:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R3111:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R3112:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R4327:Hmgxb3 UTSW 18 61167539 missense probably benign 0.11
R4710:Hmgxb3 UTSW 18 61137475 missense probably damaging 1.00
R4750:Hmgxb3 UTSW 18 61167496 missense probably benign
R4876:Hmgxb3 UTSW 18 61146534 missense possibly damaging 0.94
R5177:Hmgxb3 UTSW 18 61172194 missense probably damaging 1.00
R5490:Hmgxb3 UTSW 18 61162977 missense probably damaging 0.99
R5601:Hmgxb3 UTSW 18 61137622 missense probably damaging 1.00
R5718:Hmgxb3 UTSW 18 61140837 missense probably benign 0.05
R6011:Hmgxb3 UTSW 18 61163024 missense probably damaging 0.97
R6034:Hmgxb3 UTSW 18 61132522 missense probably damaging 1.00
R6092:Hmgxb3 UTSW 18 61137600 missense possibly damaging 0.56
R6142:Hmgxb3 UTSW 18 61136237 missense probably benign 0.00
R6419:Hmgxb3 UTSW 18 61152224 missense possibly damaging 0.71
R6675:Hmgxb3 UTSW 18 61137576 missense possibly damaging 0.86
R7130:Hmgxb3 UTSW 18 61132378 missense probably benign
Predicted Primers
Posted On2017-06-26