Incidental Mutation 'R6072:Ndufs8'
ID482558
Institutional Source Beutler Lab
Gene Symbol Ndufs8
Ensembl Gene ENSMUSG00000059734
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 8
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R6072 (G1)
Quality Score187.009
Status Not validated
Chromosome19
Chromosomal Location3908870-3912717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3909275 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 129 (T129A)
Ref Sequence ENSEMBL: ENSMUSP00000074600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001801] [ENSMUST00000051803] [ENSMUST00000075092] [ENSMUST00000126070] [ENSMUST00000135070] [ENSMUST00000145791]
Predicted Effect probably benign
Transcript: ENSMUST00000001801
SMART Domains Protein: ENSMUSP00000001801
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051803
SMART Domains Protein: ENSMUSP00000056276
Gene: ENSMUSG00000024885

DomainStartEndE-ValueType
Pfam:Aldedh 2 428 7.4e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075092
AA Change: T129A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074600
Gene: ENSMUSG00000059734
AA Change: T129A

DomainStartEndE-ValueType
Pfam:Fer4_10 108 163 2.4e-9 PFAM
Pfam:Fer4 109 129 1.1e-6 PFAM
Pfam:Fer4_4 110 126 2e-5 PFAM
Pfam:Fer4_7 112 166 1e-13 PFAM
Pfam:Fer4_9 112 167 8.8e-10 PFAM
Pfam:Fer4 145 168 5.3e-10 PFAM
Pfam:Fer4_4 149 173 3.1e-3 PFAM
low complexity region 181 193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125792
Predicted Effect probably benign
Transcript: ENSMUST00000126070
SMART Domains Protein: ENSMUSP00000120531
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 1.2e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127308
Predicted Effect probably benign
Transcript: ENSMUST00000135070
SMART Domains Protein: ENSMUSP00000121241
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145791
SMART Domains Protein: ENSMUSP00000122474
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial NADH:ubiquinone oxidoreductase, or Complex I, a multimeric enzyme of the respiratory chain responsible for NADH oxidation, ubiquinone reduction, and the ejection of protons from mitochondria. The encoded protein is involved in the binding of two of the six to eight iron-sulfur clusters of Complex I and, as such, is required in the electron transfer process. Mutations in this gene have been associated with Leigh syndrome. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Ndufs8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Ndufs8 APN 19 3911740 missense probably benign
IGL02958:Ndufs8 APN 19 3911232 missense probably benign 0.09
R4279:Ndufs8 UTSW 19 3911014 missense probably damaging 1.00
R7261:Ndufs8 UTSW 19 3911606 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTGGAGAACTCGAAGTTG -3'
(R):5'- AATCTTTTCCTTGTGGGACAGGAG -3'

Sequencing Primer
(F):5'- AGAACTCGAAGTTGGGGCCC -3'
(R):5'- GGGTCACCTGGCAGAGACTAATG -3'
Posted On2017-07-14