Incidental Mutation 'R6092:Mto1'
ID485990
Institutional Source Beutler Lab
Gene Symbol Mto1
Ensembl Gene ENSMUSG00000032342
Gene Namemitochondrial tRNA translation optimization 1
Synonyms5730419A02Rik, 2310039H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R6092 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location78448208-78475348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78460849 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 425 (I425T)
Ref Sequence ENSEMBL: ENSMUSP00000034896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034896] [ENSMUST00000148238]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034896
AA Change: I425T

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034896
Gene: ENSMUSG00000032342
AA Change: I425T

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 1.3e-6 PFAM
Pfam:FAD_oxidored 37 194 2.3e-9 PFAM
Pfam:GIDA 37 435 3.5e-153 PFAM
low complexity region 518 529 N/A INTRINSIC
GIDA_assoc_3 585 658 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133002
Predicted Effect probably benign
Transcript: ENSMUST00000148238
SMART Domains Protein: ENSMUSP00000121424
Gene: ENSMUSG00000032342

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 7.1e-7 PFAM
Pfam:Pyr_redox_2 37 156 2.1e-7 PFAM
Pfam:FAD_oxidored 37 178 1.1e-9 PFAM
Pfam:GIDA 37 184 8.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157051
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The encoded protein may also play a role in the expression of the non-syndromic and aminoglycoside-induced deafness phenotypes associated with a specific mutation in the mitochondrial 12S rRNA gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic allele show bradycardia, cardiomyopathy, worsening of arrhythmias during induction and reversal of anesthesia, and mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably benign Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably benign Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S859P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 H229Q probably benign Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 G134D probably benign Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 probably benign Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 T2265I probably benign Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y117* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 probably benign Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T147A probably damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Trpm2 A G 10: 77,925,682 F1045L probably benign Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M195K probably benign Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Mto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Mto1 APN 9 78461643 missense probably benign 0.00
IGL01362:Mto1 APN 9 78452774 missense probably benign 0.00
IGL01906:Mto1 APN 9 78464931 missense probably benign
IGL02499:Mto1 APN 9 78461512 unclassified probably benign
IGL02504:Mto1 APN 9 78460927 missense probably damaging 1.00
IGL03104:Mto1 APN 9 78449520 missense probably damaging 1.00
R0089:Mto1 UTSW 9 78473872 missense probably benign
R0325:Mto1 UTSW 9 78453004 missense probably damaging 1.00
R0566:Mto1 UTSW 9 78448301 missense possibly damaging 0.66
R0659:Mto1 UTSW 9 78457508 missense probably damaging 1.00
R0659:Mto1 UTSW 9 78470790 missense probably damaging 1.00
R0837:Mto1 UTSW 9 78473790 missense probably damaging 1.00
R1679:Mto1 UTSW 9 78464963 missense probably benign
R1899:Mto1 UTSW 9 78461517 splice site probably benign
R1900:Mto1 UTSW 9 78461517 splice site probably benign
R2235:Mto1 UTSW 9 78457564 missense possibly damaging 0.58
R3078:Mto1 UTSW 9 78458028 missense probably damaging 1.00
R5015:Mto1 UTSW 9 78461621 missense probably benign 0.25
R5420:Mto1 UTSW 9 78452827 missense probably benign
R5947:Mto1 UTSW 9 78461029 missense probably damaging 1.00
R5969:Mto1 UTSW 9 78452905 missense probably damaging 1.00
R6336:Mto1 UTSW 9 78473835 missense probably damaging 0.98
R6542:Mto1 UTSW 9 78457228 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGGAGTGAATCATAGCAGACTAAC -3'
(R):5'- AGCCGGGTGTCAGCATTATC -3'

Sequencing Primer
(F):5'- CTGGCTTAGAATTCAGAGGTCCAC -3'
(R):5'- TATCGGGGCGCAGTGACAATC -3'
Posted OnAug 16, 2017