Incidental Mutation 'R0531:Prmt1'
ID49157
Institutional Source Beutler Lab
Gene Symbol Prmt1
Ensembl Gene ENSMUSG00000109324
Gene Nameprotein arginine N-methyltransferase 1
SynonymsHrmt1l2
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0531 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44975989-44986568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44977624 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 304 (S304R)
Ref Sequence ENSEMBL: ENSMUSP00000103474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045325] [ENSMUST00000063761] [ENSMUST00000107843] [ENSMUST00000207370] [ENSMUST00000207522] [ENSMUST00000207659] [ENSMUST00000208312] [ENSMUST00000208829] [ENSMUST00000208938] [ENSMUST00000209124] [ENSMUST00000211862] [ENSMUST00000212255] [ENSMUST00000212836]
Predicted Effect probably damaging
Transcript: ENSMUST00000045325
AA Change: S251R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045365
Gene: ENSMUSG00000109324
AA Change: S251R

DomainStartEndE-ValueType
Pfam:PRMT5 41 343 3.9e-11 PFAM
Pfam:Met_10 72 184 5.4e-7 PFAM
Pfam:MTS 78 162 7e-7 PFAM
Pfam:PrmA 79 182 8.1e-10 PFAM
Pfam:Methyltransf_31 86 226 4.1e-10 PFAM
Pfam:Methyltransf_18 88 195 3.5e-9 PFAM
Pfam:Methyltransf_26 89 189 1.4e-8 PFAM
Pfam:Methyltransf_11 93 192 3.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063761
SMART Domains Protein: ENSMUSP00000069539
Gene: ENSMUSG00000007783

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.3e-21 PFAM
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 757 7.7e-167 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107843
AA Change: S304R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103474
Gene: ENSMUSG00000109324
AA Change: S304R

DomainStartEndE-ValueType
Pfam:PRMT5 41 343 1.9e-8 PFAM
Pfam:MTS 78 162 1.1e-6 PFAM
Pfam:PrmA 79 181 1.3e-9 PFAM
Pfam:Methyltransf_31 86 226 4e-10 PFAM
Pfam:Methyltransf_18 88 192 6.2e-9 PFAM
Pfam:Methyltransf_11 93 192 1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207370
AA Change: S286R

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207515
Predicted Effect probably benign
Transcript: ENSMUST00000207522
Predicted Effect possibly damaging
Transcript: ENSMUST00000207659
AA Change: S187R

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207735
Predicted Effect probably benign
Transcript: ENSMUST00000208312
Predicted Effect unknown
Transcript: ENSMUST00000208778
AA Change: S152R
Predicted Effect probably damaging
Transcript: ENSMUST00000208829
AA Change: S55R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208897
Predicted Effect probably benign
Transcript: ENSMUST00000208938
Predicted Effect probably benign
Transcript: ENSMUST00000209056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209089
Predicted Effect probably damaging
Transcript: ENSMUST00000209124
AA Change: S141R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000211862
Predicted Effect probably benign
Transcript: ENSMUST00000212255
Predicted Effect probably benign
Transcript: ENSMUST00000212836
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein arginine N-methyltransferase (PRMT) family. Post-translational modification of target proteins by PRMTs plays an important regulatory role in many biological processes, whereby PRMTs methylate arginine residues by transferring methyl groups from S-adenosyl-L-methionine to terminal guanidino nitrogen atoms. The encoded protein is a type I PRMT and is responsible for the majority of cellular arginine methylation activity. Increased expression of this gene may play a role in many types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Embryos homozygous for a null mutation die before E6.5 and exhibit abnormal embryonic tissue morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Prmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Prmt1 APN 7 44977635 unclassified probably benign
IGL03195:Prmt1 APN 7 44977571 missense probably damaging 0.98
R0110:Prmt1 UTSW 7 44978801 unclassified probably benign
R0313:Prmt1 UTSW 7 44978748 missense probably benign 0.39
R0326:Prmt1 UTSW 7 44979454 missense probably damaging 1.00
R0522:Prmt1 UTSW 7 44981779 missense probably benign 0.08
R0611:Prmt1 UTSW 7 44978801 splice site probably null
R2002:Prmt1 UTSW 7 44978724 missense probably damaging 1.00
R4712:Prmt1 UTSW 7 44981636 missense probably damaging 1.00
R6032:Prmt1 UTSW 7 44977102 unclassified probably null
R6153:Prmt1 UTSW 7 44981827 missense probably damaging 1.00
R7087:Prmt1 UTSW 7 44981583 splice site probably null
R7216:Prmt1 UTSW 7 44983573 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCAAGCTGGCACTGTTCAACTC -3'
(R):5'- ACTGAAGAACTGTTCCACCAGGCTC -3'

Sequencing Primer
(F):5'- TGTTCAACTCTACCCAGAACCTG -3'
(R):5'- ACCAGGCTCTGCTGTCAG -3'
Posted On2013-06-12