Incidental Mutation 'R6278:Ston2'
ID507791
Institutional Source Beutler Lab
Gene Symbol Ston2
Ensembl Gene ENSMUSG00000020961
Gene Namestonin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.591) question?
Stock #R6278 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location91633009-91788387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91648330 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 435 (K435E)
Ref Sequence ENSEMBL: ENSMUSP00000131098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052969] [ENSMUST00000164713]
Predicted Effect probably damaging
Transcript: ENSMUST00000052969
AA Change: K435E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053908
Gene: ENSMUSG00000020961
AA Change: K435E

DomainStartEndE-ValueType
Pfam:Stonin2_N 1 337 3e-228 PFAM
Pfam:Adap_comp_sub 554 873 7.3e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164713
AA Change: K435E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131098
Gene: ENSMUSG00000020961
AA Change: K435E

DomainStartEndE-ValueType
Pfam:Stonin2_N 1 337 1.3e-181 PFAM
Pfam:Adap_comp_sub 554 872 1.9e-65 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a membrane protein involved in regulating endocytotic complexes. The protein product is described as one of the clathrin-associated sorting proteins, adaptor molecules which ensure specific proteins are internalized. The encoded protein has also been shown to participate in synaptic vesicle recycling through interaction with synaptotagmin 1 required for neurotransmission. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit compromised endocytic synaptic vesicle sorting fidelity, hyperactivity and abnormal response to novel object. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,849 S192P probably damaging Het
Amy1 T A 3: 113,561,690 Y348F probably damaging Het
Brpf3 C A 17: 28,821,284 P893H probably benign Het
Cage1 T C 13: 38,016,419 T702A possibly damaging Het
Cdk11b A G 4: 155,649,603 probably benign Het
Cdk5rap3 T C 11: 96,911,903 Y207C probably damaging Het
Cenpc1 T C 5: 86,035,535 K465R probably damaging Het
Cldn14 A C 16: 93,919,598 L120R possibly damaging Het
Cyp2c69 A T 19: 39,843,063 C435* probably null Het
Dmxl2 T A 9: 54,415,762 E1446V probably damaging Het
Dnah17 T A 11: 118,126,290 D208V probably damaging Het
Eif4g3 G T 4: 138,188,083 G1430V possibly damaging Het
Eif5 T A 12: 111,542,793 D284E probably benign Het
Fam47e T C 5: 92,562,517 L125P probably damaging Het
Far1 A G 7: 113,568,137 I476M probably benign Het
Fsip2 A T 2: 82,988,898 I4992L probably benign Het
Gli3 T A 13: 15,725,113 N1028K possibly damaging Het
Gm13128 C T 4: 144,330,267 P7S probably damaging Het
Gucy1a1 T C 3: 82,097,634 K615E probably damaging Het
Gykl1 G T 18: 52,695,208 S496I probably benign Het
Hmcn1 C T 1: 150,697,419 probably null Het
Itga2 T A 13: 114,845,888 H1027L probably benign Het
Kif24 A T 4: 41,423,498 V251E probably damaging Het
Nupr1 T C 7: 126,625,346 Y30C probably damaging Het
Olfr1137 A T 2: 87,711,471 L145* probably null Het
Olfr1475 T A 19: 13,479,755 M148L probably benign Het
Olfr943 T A 9: 39,184,298 I40N probably damaging Het
Olfr998 A G 2: 85,590,998 I153V probably benign Het
P2ry1 T A 3: 61,003,794 I118N possibly damaging Het
Pcdh1 C T 18: 38,199,210 V247M probably benign Het
Pdia5 A G 16: 35,429,923 V222A possibly damaging Het
Plce1 G A 19: 38,725,051 probably null Het
Ppm1m T C 9: 106,197,228 R239G probably damaging Het
Prkcz A T 4: 155,268,195 F492I probably damaging Het
Rpl6 T C 5: 121,208,849 I269T possibly damaging Het
Scoc T C 8: 83,458,336 S2G unknown Het
Spesp1 A T 9: 62,272,639 M329K probably benign Het
Synj2 A T 17: 5,975,874 L69F probably damaging Het
Tigd5 T C 15: 75,909,993 I68T probably damaging Het
Tmcc2 A T 1: 132,358,982 M577K probably damaging Het
Tmem131l A T 3: 83,942,491 I263N possibly damaging Het
Trip13 T C 13: 73,913,320 E408G probably benign Het
Txnl4b T C 8: 109,569,103 probably null Het
Ube2o T C 11: 116,539,543 E1123G probably damaging Het
Vmn1r123 A G 7: 21,162,849 H222R possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Zc3h13 T A 14: 75,330,423 V1052D probably benign Het
Other mutations in Ston2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Ston2 APN 12 91648748 missense possibly damaging 0.67
IGL02102:Ston2 APN 12 91639724 makesense probably null
IGL03177:Ston2 APN 12 91647657 missense probably damaging 1.00
IGL03233:Ston2 APN 12 91647853 missense probably damaging 1.00
PIT4305001:Ston2 UTSW 12 91648502 missense possibly damaging 0.90
R0158:Ston2 UTSW 12 91740602 missense probably damaging 1.00
R0365:Ston2 UTSW 12 91647860 missense probably benign 0.00
R0671:Ston2 UTSW 12 91740466 splice site probably null
R1005:Ston2 UTSW 12 91648848 missense possibly damaging 0.56
R1381:Ston2 UTSW 12 91740492 missense probably damaging 0.97
R1507:Ston2 UTSW 12 91641680 missense probably benign 0.02
R1737:Ston2 UTSW 12 91647907 missense probably damaging 1.00
R4029:Ston2 UTSW 12 91648263 missense possibly damaging 0.59
R4030:Ston2 UTSW 12 91648263 missense possibly damaging 0.59
R4552:Ston2 UTSW 12 91641872 missense probably damaging 1.00
R4569:Ston2 UTSW 12 91639722 makesense probably null
R4864:Ston2 UTSW 12 91648674 missense possibly damaging 0.91
R6637:Ston2 UTSW 12 91714112 missense probably damaging 0.97
R6679:Ston2 UTSW 12 91648096 missense probably damaging 1.00
R7142:Ston2 UTSW 12 91647235 missense probably damaging 1.00
X0064:Ston2 UTSW 12 91648905 missense possibly damaging 0.95
Z1088:Ston2 UTSW 12 91649067 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGTCTATCCTCAAGCTGTGGATC -3'
(R):5'- TGATGATTCAGGCAAAAGCCAG -3'

Sequencing Primer
(F):5'- TCAAGCTGTGGATCCTCCCG -3'
(R):5'- GGCAAAAGCCAGCCCCAC -3'
Posted On2018-03-15