Incidental Mutation 'R6317:Aoc2'
ID510048
Institutional Source Beutler Lab
Gene Symbol Aoc2
Ensembl Gene ENSMUSG00000078651
Gene Nameamine oxidase, copper containing 2 (retina-specific)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R6317 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101325063-101329702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101325466 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 125 (F125S)
Ref Sequence ENSEMBL: ENSMUSP00000040255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019470] [ENSMUST00000041095] [ENSMUST00000107264] [ENSMUST00000151385]
Predicted Effect probably benign
Transcript: ENSMUST00000019470
SMART Domains Protein: ENSMUSP00000019470
Gene: ENSMUSG00000078652

DomainStartEndE-ValueType
Pfam:PA28_alpha 9 69 2.9e-30 PFAM
Pfam:PA28_beta 108 252 3e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041095
AA Change: F125S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040255
Gene: ENSMUSG00000078651
AA Change: F125S

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 165 263 5.7e-22 PFAM
Pfam:Cu_amine_oxid 309 718 3.7e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107264
AA Change: F125S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102885
Gene: ENSMUSG00000078651
AA Change: F125S

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 8.2e-24 PFAM
Pfam:Cu_amine_oxidN3 165 263 9.9e-20 PFAM
Pfam:Cu_amine_oxid 308 605 5.9e-86 PFAM
Pfam:Cu_amine_oxid 600 694 7.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131170
Predicted Effect probably benign
Transcript: ENSMUST00000151385
SMART Domains Protein: ENSMUSP00000116996
Gene: ENSMUSG00000078652

DomainStartEndE-ValueType
Pfam:PA28_alpha 17 81 1.5e-32 PFAM
Pfam:PA28_beta 116 203 5.6e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes and ammonia in the presence of copper and quinone cofactor. This gene shows high sequence similarity to copper amine oxidases from various species ranging from bacteria to mammals. The protein contains several conserved motifs including the active site of amine oxidases and the histidine residues that likely bind copper. It may be a critical modulator of signal transmission in retina, possibly by degrading the biogenic amines dopamine, histamine, and putrescine. This gene may be a candidate gene for hereditary ocular diseases. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,468,193 N206S probably damaging Het
Abcf2 A T 5: 24,569,158 Y315* probably null Het
Adck1 T G 12: 88,402,151 V133G probably damaging Het
As3mt A G 19: 46,724,971 D319G probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz1a T C 12: 54,954,800 Q145R possibly damaging Het
BC067074 T A 13: 113,368,268 L1977H probably benign Het
Bhlhe22 A G 3: 18,055,614 E276G probably damaging Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Ces1h A G 8: 93,357,418 F388S unknown Het
Col6a5 T A 9: 105,889,067 N1885Y probably damaging Het
Corin A T 5: 72,339,045 C522S probably damaging Het
Csmd1 G T 8: 16,710,642 T159K possibly damaging Het
Cwc27 T A 13: 104,804,261 K197* probably null Het
Cyp20a1 T C 1: 60,352,124 S26P probably damaging Het
Daxx T A 17: 33,911,975 D321E probably damaging Het
Gria2 A C 3: 80,741,004 Y142D possibly damaging Het
Gspt1 T C 16: 11,223,208 probably null Het
Ighv1-80 A T 12: 115,912,645 V17D probably damaging Het
Ints4 T A 7: 97,529,218 L675* probably null Het
Kif13a C T 13: 46,826,757 R173Q probably damaging Het
Map3k2 T C 18: 32,203,033 I91T probably damaging Het
Map3k8 A G 18: 4,348,979 probably null Het
Mcemp1 G A 8: 3,667,284 W101* probably null Het
Mgea5 A T 19: 45,771,680 probably null Het
Naca T C 10: 128,044,124 I1675T probably benign Het
Nol9 T C 4: 152,041,057 F155S probably damaging Het
Obscn C A 11: 59,069,895 D3406Y probably damaging Het
Obsl1 A G 1: 75,489,629 V1485A possibly damaging Het
Olfr151 T C 9: 37,730,429 K185E possibly damaging Het
Otog C A 7: 46,301,215 P337H probably damaging Het
Patl1 T C 19: 11,920,878 L140P probably damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Pex11g G T 8: 3,464,092 D23E probably damaging Het
Phactr2 A T 10: 13,261,882 M172K probably damaging Het
Plce1 G A 19: 38,524,530 W91* probably null Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Podn A G 4: 108,027,160 F44S probably damaging Het
Polr3e A G 7: 120,927,982 D87G possibly damaging Het
Prmt2 T A 10: 76,222,517 I153F probably benign Het
Prpf6 T C 2: 181,631,436 V258A probably benign Het
Ptpn21 G T 12: 98,689,262 A482E probably damaging Het
Qrich1 A T 9: 108,534,292 N339Y probably damaging Het
Rabgap1 T A 2: 37,542,647 V750D possibly damaging Het
Reg3d G A 6: 78,377,445 P58S probably damaging Het
Rp1 A G 1: 4,041,989 L1213P unknown Het
Sema6b A G 17: 56,124,047 L872S probably benign Het
Serpinb7 T C 1: 107,451,706 I281T probably damaging Het
Shank2 T C 7: 144,285,084 V685A possibly damaging Het
Slc28a2 A G 2: 122,454,499 I323V possibly damaging Het
Slc7a6 A T 8: 106,192,467 I228F probably damaging Het
Slc9a9 A G 9: 94,939,459 T300A possibly damaging Het
Spta1 A G 1: 174,241,087 N2151S probably damaging Het
Sult2a1 T A 7: 13,836,020 I96L probably benign Het
Tgm2 T C 2: 158,124,150 D528G probably benign Het
Ubl7 T C 9: 57,911,173 probably null Het
Vcan T A 13: 89,691,597 I983L probably benign Het
Vmn1r172 T C 7: 23,660,317 L209P probably damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn1r3 T C 4: 3,184,993 S105G probably benign Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Other mutations in Aoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01900:Aoc2 APN 11 101328823 missense probably damaging 1.00
IGL02340:Aoc2 APN 11 101326375 missense probably damaging 1.00
IGL02382:Aoc2 APN 11 101326672 missense probably damaging 1.00
R0063:Aoc2 UTSW 11 101326071 missense probably damaging 1.00
R0063:Aoc2 UTSW 11 101326071 missense probably damaging 1.00
R0398:Aoc2 UTSW 11 101325553 missense possibly damaging 0.56
R1430:Aoc2 UTSW 11 101326495 missense probably damaging 1.00
R1681:Aoc2 UTSW 11 101325192 missense probably benign
R3157:Aoc2 UTSW 11 101329276 missense probably damaging 1.00
R3158:Aoc2 UTSW 11 101329276 missense probably damaging 1.00
R4159:Aoc2 UTSW 11 101325296 missense probably damaging 0.98
R4747:Aoc2 UTSW 11 101328820 critical splice acceptor site probably null
R5120:Aoc2 UTSW 11 101325714 missense probably benign 0.00
R5902:Aoc2 UTSW 11 101329246 missense probably damaging 1.00
R6032:Aoc2 UTSW 11 101325801 missense probably damaging 1.00
R6032:Aoc2 UTSW 11 101325801 missense probably damaging 1.00
R6778:Aoc2 UTSW 11 101325361 missense probably damaging 0.99
R7323:Aoc2 UTSW 11 101328545 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGAGCTTCCTGACCAAGC -3'
(R):5'- GAGCCATTGTAGTTCAAGACAG -3'

Sequencing Primer
(F):5'- TTCCTGACCAAGCACCTGG -3'
(R):5'- GCCATTGTAGTTCAAGACAGAAGCC -3'
Posted On2018-04-02