Incidental Mutation 'R6317:Prpf6'
ID510015
Institutional Source Beutler Lab
Gene Symbol Prpf6
Ensembl Gene ENSMUSG00000002455
Gene Namepre-mRNA splicing factor 6
SynonymsANT-1, U5-102K, 2610031L17Rik, 1190003A07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6317 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181591868-181655660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181631436 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 258 (V258A)
Ref Sequence ENSEMBL: ENSMUSP00000121340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002529] [ENSMUST00000136481]
Predicted Effect probably benign
Transcript: ENSMUST00000002529
AA Change: V258A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000002529
Gene: ENSMUSG00000002455
AA Change: V258A

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 2.5e-52 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136481
AA Change: V258A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121340
Gene: ENSMUSG00000002455
AA Change: V258A

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 1.3e-62 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139955
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in pre-mRNA splicing, possibly acting as a bridging factor between U5 and U4/U6 snRNPs in formation of the spliceosome. The encoded protein also can bind androgen receptor, providing a link between transcriptional activation and splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,468,193 N206S probably damaging Het
Abcf2 A T 5: 24,569,158 Y315* probably null Het
Adck1 T G 12: 88,402,151 V133G probably damaging Het
Aoc2 T C 11: 101,325,466 F125S probably damaging Het
As3mt A G 19: 46,724,971 D319G probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz1a T C 12: 54,954,800 Q145R possibly damaging Het
BC067074 T A 13: 113,368,268 L1977H probably benign Het
Bhlhe22 A G 3: 18,055,614 E276G probably damaging Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Ces1h A G 8: 93,357,418 F388S unknown Het
Col6a5 T A 9: 105,889,067 N1885Y probably damaging Het
Corin A T 5: 72,339,045 C522S probably damaging Het
Csmd1 G T 8: 16,710,642 T159K possibly damaging Het
Cwc27 T A 13: 104,804,261 K197* probably null Het
Cyp20a1 T C 1: 60,352,124 S26P probably damaging Het
Daxx T A 17: 33,911,975 D321E probably damaging Het
Gria2 A C 3: 80,741,004 Y142D possibly damaging Het
Gspt1 T C 16: 11,223,208 probably null Het
Ighv1-80 A T 12: 115,912,645 V17D probably damaging Het
Ints4 T A 7: 97,529,218 L675* probably null Het
Kif13a C T 13: 46,826,757 R173Q probably damaging Het
Map3k2 T C 18: 32,203,033 I91T probably damaging Het
Map3k8 A G 18: 4,348,979 probably null Het
Mcemp1 G A 8: 3,667,284 W101* probably null Het
Mgea5 A T 19: 45,771,680 probably null Het
Naca T C 10: 128,044,124 I1675T probably benign Het
Nol9 T C 4: 152,041,057 F155S probably damaging Het
Obscn C A 11: 59,069,895 D3406Y probably damaging Het
Obsl1 A G 1: 75,489,629 V1485A possibly damaging Het
Olfr151 T C 9: 37,730,429 K185E possibly damaging Het
Otog C A 7: 46,301,215 P337H probably damaging Het
Patl1 T C 19: 11,920,878 L140P probably damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Pex11g G T 8: 3,464,092 D23E probably damaging Het
Phactr2 A T 10: 13,261,882 M172K probably damaging Het
Plce1 G A 19: 38,524,530 W91* probably null Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Podn A G 4: 108,027,160 F44S probably damaging Het
Polr3e A G 7: 120,927,982 D87G possibly damaging Het
Prmt2 T A 10: 76,222,517 I153F probably benign Het
Ptpn21 G T 12: 98,689,262 A482E probably damaging Het
Qrich1 A T 9: 108,534,292 N339Y probably damaging Het
Rabgap1 T A 2: 37,542,647 V750D possibly damaging Het
Reg3d G A 6: 78,377,445 P58S probably damaging Het
Rp1 A G 1: 4,041,989 L1213P unknown Het
Sema6b A G 17: 56,124,047 L872S probably benign Het
Serpinb7 T C 1: 107,451,706 I281T probably damaging Het
Shank2 T C 7: 144,285,084 V685A possibly damaging Het
Slc28a2 A G 2: 122,454,499 I323V possibly damaging Het
Slc7a6 A T 8: 106,192,467 I228F probably damaging Het
Slc9a9 A G 9: 94,939,459 T300A possibly damaging Het
Spta1 A G 1: 174,241,087 N2151S probably damaging Het
Sult2a1 T A 7: 13,836,020 I96L probably benign Het
Tgm2 T C 2: 158,124,150 D528G probably benign Het
Ubl7 T C 9: 57,911,173 probably null Het
Vcan T A 13: 89,691,597 I983L probably benign Het
Vmn1r172 T C 7: 23,660,317 L209P probably damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn1r3 T C 4: 3,184,993 S105G probably benign Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Other mutations in Prpf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Prpf6 APN 2 181631511 missense probably benign
IGL01729:Prpf6 APN 2 181654917 missense probably damaging 1.00
IGL02077:Prpf6 APN 2 181640664 missense probably damaging 1.00
IGL02187:Prpf6 APN 2 181616016 missense probably damaging 1.00
IGL02452:Prpf6 APN 2 181649085 missense probably benign 0.00
IGL02881:Prpf6 APN 2 181632071 missense probably benign 0.21
IGL03220:Prpf6 APN 2 181632879 missense probably damaging 1.00
IGL02837:Prpf6 UTSW 2 181622263 missense probably damaging 1.00
R0069:Prpf6 UTSW 2 181615963 splice site probably null
R0189:Prpf6 UTSW 2 181655457 missense probably benign 0.00
R0479:Prpf6 UTSW 2 181651127 missense probably benign 0.18
R0532:Prpf6 UTSW 2 181622211 missense possibly damaging 0.71
R0628:Prpf6 UTSW 2 181636048 missense probably damaging 0.96
R0674:Prpf6 UTSW 2 181631974 missense probably benign 0.05
R1863:Prpf6 UTSW 2 181608174 missense possibly damaging 0.81
R1954:Prpf6 UTSW 2 181632077 missense probably benign
R1955:Prpf6 UTSW 2 181632077 missense probably benign
R4612:Prpf6 UTSW 2 181632079 missense possibly damaging 0.81
R4627:Prpf6 UTSW 2 181601474 missense probably damaging 0.96
R5033:Prpf6 UTSW 2 181650106 missense possibly damaging 0.69
R5053:Prpf6 UTSW 2 181649453 missense probably benign 0.00
R5121:Prpf6 UTSW 2 181636043 missense probably benign
R5181:Prpf6 UTSW 2 181649546 missense probably damaging 0.98
R5380:Prpf6 UTSW 2 181608266 missense probably damaging 1.00
R5490:Prpf6 UTSW 2 181608165 missense probably benign 0.01
R5638:Prpf6 UTSW 2 181645588 missense probably benign 0.32
R5680:Prpf6 UTSW 2 181649140 missense probably damaging 0.99
R6152:Prpf6 UTSW 2 181621787 missense probably damaging 1.00
R6252:Prpf6 UTSW 2 181647363 missense probably damaging 1.00
R6501:Prpf6 UTSW 2 181621920 nonsense probably null
R6789:Prpf6 UTSW 2 181616051 nonsense probably null
R7023:Prpf6 UTSW 2 181620640 missense probably damaging 1.00
R7043:Prpf6 UTSW 2 181649504 missense probably benign
R7214:Prpf6 UTSW 2 181640596 missense probably damaging 1.00
R7538:Prpf6 UTSW 2 181652455 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GACAAGCTGCCTGGTTTATCAC -3'
(R):5'- TCTAGTTCATCATAGGCATTGACC -3'

Sequencing Primer
(F):5'- AAGCTGCCTGGTTTATCACTTTCAG -3'
(R):5'- ATCATTTCTCAGAACATCCATGTC -3'
Posted On2018-04-02