Incidental Mutation 'R6349:Abca8b'
ID512457
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene NameATP-binding cassette, sub-family A (ABC1), member 8b
SynonymsAbca8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6349 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location109932190-109995845 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 109934718 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
Predicted Effect probably null
Transcript: ENSMUST00000020948
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106669
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149226
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 intron probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGGAGGAGCTTCCACTTTATG -3'
(R):5'- GTTCCTCCAGTCAAAGTAAATGTG -3'

Sequencing Primer
(F):5'- CACTTTATGGAGGAGTCTAATTCTTC -3'
(R):5'- CTCCAGTCAAAGTAAATGTGTTAATG -3'
Posted On2018-04-27