Incidental Mutation 'R6498:Exosc10'
ID523097
Institutional Source Beutler Lab
Gene Symbol Exosc10
Ensembl Gene ENSMUSG00000017264
Gene Nameexosome component 10
SynonymsPmscl2, PM-Scl, p3, p2, PM/Scl-100, RRP6, p4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6498 (G1)
Quality Score159.009
Status Validated
Chromosome4
Chromosomal Location148558429-148582401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148573338 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 647 (V647A)
Ref Sequence ENSEMBL: ENSMUSP00000075401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017408] [ENSMUST00000076022] [ENSMUST00000097781]
Predicted Effect probably benign
Transcript: ENSMUST00000017408
AA Change: V647A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017408
Gene: ENSMUSG00000017264
AA Change: V647A

DomainStartEndE-ValueType
Pfam:PMC2NT 44 133 2.7e-26 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 745 760 N/A INTRINSIC
coiled coil region 769 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076022
AA Change: V647A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075401
Gene: ENSMUSG00000017264
AA Change: V647A

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 5.1e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 720 735 N/A INTRINSIC
coiled coil region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097781
SMART Domains Protein: ENSMUSP00000095388
Gene: ENSMUSG00000017264

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 1.4e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173892
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Exosc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Exosc10 APN 4 148565271 missense probably damaging 1.00
IGL01591:Exosc10 APN 4 148562887 unclassified probably benign
IGL01990:Exosc10 APN 4 148566410 missense possibly damaging 0.83
IGL02137:Exosc10 APN 4 148561133 missense probably damaging 0.97
IGL02186:Exosc10 APN 4 148565298 missense probably damaging 0.96
IGL02412:Exosc10 APN 4 148568392 missense probably benign 0.15
IGL02880:Exosc10 APN 4 148576183 missense probably damaging 1.00
R0172:Exosc10 UTSW 4 148565357 missense probably benign 0.02
R0267:Exosc10 UTSW 4 148562756 missense probably damaging 1.00
R0592:Exosc10 UTSW 4 148581113 missense probably benign
R1122:Exosc10 UTSW 4 148566364 missense possibly damaging 0.86
R1218:Exosc10 UTSW 4 148570401 missense probably damaging 1.00
R1498:Exosc10 UTSW 4 148581786 missense possibly damaging 0.66
R1591:Exosc10 UTSW 4 148568383 missense probably benign 0.04
R1719:Exosc10 UTSW 4 148568503 missense probably damaging 1.00
R1760:Exosc10 UTSW 4 148578469 nonsense probably null
R3727:Exosc10 UTSW 4 148565277 missense probably damaging 1.00
R3842:Exosc10 UTSW 4 148563865 nonsense probably null
R3876:Exosc10 UTSW 4 148572919 missense probably benign 0.00
R4476:Exosc10 UTSW 4 148565324 missense probably damaging 0.98
R4750:Exosc10 UTSW 4 148562394 missense possibly damaging 0.69
R5306:Exosc10 UTSW 4 148562392 missense probably benign 0.13
R5438:Exosc10 UTSW 4 148566342 nonsense probably null
R5835:Exosc10 UTSW 4 148565387 missense probably damaging 1.00
R5925:Exosc10 UTSW 4 148573362 missense probably benign 0.01
R6116:Exosc10 UTSW 4 148573353 missense probably benign 0.08
R6217:Exosc10 UTSW 4 148582311 synonymous probably null
R6365:Exosc10 UTSW 4 148561105 missense probably benign 0.13
R6495:Exosc10 UTSW 4 148562872 missense probably benign 0.45
R6772:Exosc10 UTSW 4 148581134 missense probably damaging 1.00
R7297:Exosc10 UTSW 4 148580377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATCTCTTTGGACCCCATGAC -3'
(R):5'- TGTAGAAAGCTCCACACCTCTC -3'

Sequencing Primer
(F):5'- GGACCCCATGACTGTTCCCAC -3'
(R):5'- AAGCTCCACACCTCTCTAGCTTTAC -3'
Posted On2018-06-06