Incidental Mutation 'R6498:Gls'
ID523090
Institutional Source Beutler Lab
Gene Symbol Gls
Ensembl Gene ENSMUSG00000026103
Gene Nameglutaminase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location52163448-52233232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 52220039 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 134 (N134K)
Ref Sequence ENSEMBL: ENSMUSP00000110158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114510] [ENSMUST00000114512] [ENSMUST00000114513]
Predicted Effect probably benign
Transcript: ENSMUST00000114510
AA Change: N134K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110155
Gene: ENSMUSG00000026103
AA Change: N134K

DomainStartEndE-ValueType
low complexity region 56 77 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
Pfam:Glutaminase 249 535 3e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114512
SMART Domains Protein: ENSMUSP00000110157
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
Pfam:Glutaminase 66 352 1.7e-125 PFAM
ANK 407 437 3.9e-6 SMART
ANK 441 470 3.6e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114513
AA Change: N134K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110158
Gene: ENSMUSG00000026103
AA Change: N134K

DomainStartEndE-ValueType
low complexity region 56 77 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
Pfam:Glutaminase 249 535 4.2e-123 PFAM
ANK 590 620 6.02e-4 SMART
ANK 624 653 5.69e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151694
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations die within 1 day postnatally with abnormal respiratory function and goal-oriented behavior toward dam. Mice homozygous for another allele exhibit abnormal TNFA-stimulated astrocyte extracellular vesicle release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Gls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Gls APN 1 52188708 missense probably damaging 1.00
IGL01366:Gls APN 1 52168399 missense probably damaging 1.00
IGL01367:Gls APN 1 52168399 missense probably damaging 1.00
IGL01832:Gls APN 1 52168409 splice site probably null
IGL02045:Gls APN 1 52219515 missense probably benign 0.01
LCD18:Gls UTSW 1 52183367 intron probably benign
R0268:Gls UTSW 1 52232694 small deletion probably benign
R0373:Gls UTSW 1 52188699 missense probably damaging 1.00
R0590:Gls UTSW 1 52212375 unclassified probably benign
R1440:Gls UTSW 1 52191134 missense possibly damaging 0.59
R1628:Gls UTSW 1 52232676 missense probably benign 0.06
R3684:Gls UTSW 1 52166293 missense probably damaging 1.00
R3697:Gls UTSW 1 52199764 missense possibly damaging 0.65
R3778:Gls UTSW 1 52168912 missense probably benign 0.05
R3824:Gls UTSW 1 52232988 missense possibly damaging 0.83
R4062:Gls UTSW 1 52196748 missense probably damaging 1.00
R4441:Gls UTSW 1 52196163 critical splice donor site probably null
R4740:Gls UTSW 1 52232788 missense probably damaging 0.99
R4816:Gls UTSW 1 52199945 intron probably benign
R5281:Gls UTSW 1 52191157 missense probably damaging 1.00
R5712:Gls UTSW 1 52196752 missense probably damaging 1.00
R6163:Gls UTSW 1 52215576 missense probably benign 0.00
R6357:Gls UTSW 1 52219506 missense probably damaging 0.99
R7187:Gls UTSW 1 52219980 missense probably damaging 1.00
R7413:Gls UTSW 1 52215576 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGTTCAGCAATACTATAGAATGG -3'
(R):5'- GTCAACGAACCATAGATATACTTGCAC -3'

Sequencing Primer
(F):5'- AGAATGGGCTTAGTATTACGTCC -3'
(R):5'- GGCATGCACACACATTTTCTATTG -3'
Posted On2018-06-06