Incidental Mutation 'R6786:Nfix'
ID532376
Institutional Source Beutler Lab
Gene Symbol Nfix
Ensembl Gene ENSMUSG00000001911
Gene Namenuclear factor I/X
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R6786 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84699876-84800344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84727647 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 219 (S219T)
Ref Sequence ENSEMBL: ENSMUSP00000115691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000098571] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]
Predicted Effect probably damaging
Transcript: ENSMUST00000076715
AA Change: S219T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911
AA Change: S219T

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.1e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 322 7.4e-32 PFAM
Pfam:CTF_NFI 313 396 3.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098571
SMART Domains Protein: ENSMUSP00000096170
Gene: ENSMUSG00000074203

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099070
AA Change: S219T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911
AA Change: S219T

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.7e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 437 2.7e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109762
AA Change: S211T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911
AA Change: S211T

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.1e-27 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 312 5.4e-32 PFAM
Pfam:CTF_NFI 305 387 3.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109764
AA Change: S211T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911
AA Change: S211T

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1e-28 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 494 9.8e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126806
AA Change: S219T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911
AA Change: S219T

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 7.1e-31 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 488 1.5e-83 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a C A 4: 56,744,116 Y214* probably null Het
Adnp2 A G 18: 80,129,745 V483A probably benign Het
Aif1 C T 17: 35,171,496 V93M probably damaging Het
Alpk2 A G 18: 65,306,634 S563P probably benign Het
Ank2 A T 3: 126,958,932 N378K probably damaging Het
Ano4 C T 10: 88,992,870 probably null Het
Asxl3 G A 18: 22,525,440 C2169Y probably damaging Het
Atp2b1 T C 10: 99,016,959 C101R probably damaging Het
BC052040 A G 2: 115,631,981 I65V probably benign Het
Bcs1l C T 1: 74,590,685 R224C probably damaging Het
Car2 T C 3: 14,886,650 probably benign Het
Cbln1 T C 8: 87,472,029 N71S probably benign Het
Cdh8 T A 8: 99,223,947 T224S probably benign Het
Cep131 G A 11: 120,065,392 R1014W probably damaging Het
Cfap61 T C 2: 146,045,443 S603P possibly damaging Het
Chd8 G T 14: 52,226,668 L659I probably benign Het
Ckap5 G A 2: 91,557,575 G255D probably benign Het
Clec18a C A 8: 111,080,940 W126L probably benign Het
Cux1 T A 5: 136,567,231 N4Y probably damaging Het
Dgcr8 A T 16: 18,283,829 Y196* probably null Het
Dnah14 A T 1: 181,641,405 I1267F probably benign Het
Dock7 T C 4: 99,061,292 N438D probably benign Het
Dock8 A T 19: 25,183,022 H1763L possibly damaging Het
Fpr-rs6 A T 17: 20,182,838 M87K possibly damaging Het
Gabrg1 A G 5: 70,754,267 S339P probably benign Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm11487 A T 4: 73,403,606 M64K possibly damaging Het
Gm12695 A G 4: 96,762,821 S132P probably damaging Het
Gm3443 T A 19: 21,555,764 C31S probably damaging Het
Gm9573 T C 17: 35,623,165 probably benign Het
Gzmf A T 14: 56,206,995 F40L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Ikbkap T C 4: 56,771,555 D914G possibly damaging Het
Lrguk A G 6: 34,095,587 E604G probably benign Het
Marveld3 C A 8: 109,948,100 K361N probably benign Het
Mgat4b A T 11: 50,230,698 Y47F probably damaging Het
Mmel1 G T 4: 154,892,428 E520* probably null Het
Myod1 A G 7: 46,378,317 T294A probably benign Het
Nr4a2 A G 2: 57,111,908 F115L probably benign Het
Numa1 A C 7: 101,992,638 M98L probably benign Het
Olfr1458 T C 19: 13,103,203 I28V probably benign Het
P3h1 C T 4: 119,237,954 L303F possibly damaging Het
Pias4 G A 10: 81,157,246 T5I probably damaging Het
Pik3ip1 A G 11: 3,332,124 N68S probably benign Het
Pkdrej T C 15: 85,818,649 T1029A probably benign Het
Recql A T 6: 142,364,552 D517E probably benign Het
Sall2 G T 14: 52,314,621 H372Q probably damaging Het
Scn8a A C 15: 101,032,215 I1436L probably benign Het
Slc4a5 T C 6: 83,296,747 probably null Het
Stox2 A C 8: 47,186,465 F898C probably damaging Het
Sumo2 A T 11: 115,523,775 probably null Het
Sycp2 C T 2: 178,383,552 E366K possibly damaging Het
Tanc1 A G 2: 59,791,806 K423R probably benign Het
Tbx21 T A 11: 97,115,046 Q31L possibly damaging Het
Tcrg-C1 A T 13: 19,216,476 D125V unknown Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Trav18 G A 14: 53,831,665 V55I probably benign Het
Trim55 A G 3: 19,672,774 D335G probably benign Het
Trim71 T A 9: 114,512,704 T837S probably benign Het
Vmn1r56 T C 7: 5,195,962 T219A probably benign Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Xaf1 A G 11: 72,306,635 T146A probably benign Het
Zdbf2 T C 1: 63,304,520 V686A possibly damaging Het
Zfp65 T C 13: 67,708,011 H383R probably damaging Het
Zfp932 A G 5: 110,009,740 T435A probably damaging Het
Zfp947 C T 17: 22,145,769 G308D probably benign Het
Zswim3 T A 2: 164,820,851 V417E probably damaging Het
Other mutations in Nfix
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nfix APN 8 84726477 missense probably damaging 0.99
IGL01919:Nfix APN 8 84726474 missense probably damaging 1.00
IGL01950:Nfix APN 8 84713786 makesense probably null
IGL02862:Nfix APN 8 84713846 missense probably benign 0.07
R0142:Nfix UTSW 8 84721686 missense probably damaging 1.00
R0309:Nfix UTSW 8 84721774 missense probably damaging 1.00
R0600:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0622:Nfix UTSW 8 84726482 missense probably damaging 0.99
R0628:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0882:Nfix UTSW 8 84727925 missense probably damaging 1.00
R0893:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0975:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1014:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1015:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1162:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1241:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1381:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1513:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1521:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1618:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1865:Nfix UTSW 8 84772275 missense possibly damaging 0.73
R1912:Nfix UTSW 8 84721677 missense probably damaging 1.00
R1974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R2208:Nfix UTSW 8 84716247 frame shift probably null
R2251:Nfix UTSW 8 84716170 missense probably benign 0.03
R2268:Nfix UTSW 8 84716247 frame shift probably null
R2270:Nfix UTSW 8 84716247 frame shift probably null
R2272:Nfix UTSW 8 84727175 missense probably damaging 1.00
R2346:Nfix UTSW 8 84716247 frame shift probably null
R2350:Nfix UTSW 8 84716247 frame shift probably null
R2963:Nfix UTSW 8 84716247 frame shift probably null
R2983:Nfix UTSW 8 84716247 frame shift probably null
R3008:Nfix UTSW 8 84716247 frame shift probably null
R3727:Nfix UTSW 8 84716247 frame shift probably null
R3791:Nfix UTSW 8 84716247 frame shift probably null
R4163:Nfix UTSW 8 84716247 frame shift probably null
R4164:Nfix UTSW 8 84716247 frame shift probably null
R4201:Nfix UTSW 8 84716247 frame shift probably null
R4206:Nfix UTSW 8 84716247 frame shift probably null
R4609:Nfix UTSW 8 84726490 missense probably damaging 1.00
R4801:Nfix UTSW 8 84716247 frame shift probably null
R4802:Nfix UTSW 8 84716247 frame shift probably null
R4914:Nfix UTSW 8 84771829 missense probably benign 0.00
R4915:Nfix UTSW 8 84771829 missense probably benign 0.00
R4916:Nfix UTSW 8 84771829 missense probably benign 0.00
R4918:Nfix UTSW 8 84771829 missense probably benign 0.00
R5013:Nfix UTSW 8 84772084 missense possibly damaging 0.86
R5290:Nfix UTSW 8 84713777 nonsense probably null
R6418:Nfix UTSW 8 84727149 missense probably benign 0.01
R6554:Nfix UTSW 8 84727650 missense possibly damaging 0.93
T0970:Nfix UTSW 8 84726483 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GATTCTCTGGGCAACGAACG -3'
(R):5'- TCAGCTGTCCACTGACTTGG -3'

Sequencing Primer
(F):5'- AACGAACGGCTCCTCTCAGG -3'
(R):5'- TGTCCACTGACTTGGGCTGC -3'
Posted On2018-08-29