Incidental Mutation 'R6895:Sfrp5'
ID538310
Institutional Source Beutler Lab
Gene Symbol Sfrp5
Ensembl Gene ENSMUSG00000018822
Gene Namesecreted frizzled-related sequence protein 5
SynonymsSARP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location42197971-42202252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42199788 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 197 (S197R)
Ref Sequence ENSEMBL: ENSMUSP00000018966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018966]
Predicted Effect probably damaging
Transcript: ENSMUST00000018966
AA Change: S197R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018966
Gene: ENSMUSG00000018822
AA Change: S197R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FRI 49 164 6.28e-58 SMART
C345C 191 294 1e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Secreted frizzled-related protein 5 (SFRP5) is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. SFRP5 and SFRP1 may be involved in determining the polarity of photoreceptor cells in the retina. SFRP5 is highly expressed in the retinal pigment epithelium, and moderately expressed in the pancreas. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no developmental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Sfrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Sfrp5 APN 19 42199029 missense probably benign 0.00
IGL03347:Sfrp5 APN 19 42198768 missense probably benign 0.00
R1686:Sfrp5 UTSW 19 42201704 missense possibly damaging 0.88
R1911:Sfrp5 UTSW 19 42198798 missense probably benign
R2005:Sfrp5 UTSW 19 42198836 missense probably benign 0.03
R3815:Sfrp5 UTSW 19 42198791 missense probably benign 0.06
R3930:Sfrp5 UTSW 19 42201818 missense probably damaging 1.00
R5829:Sfrp5 UTSW 19 42201656 missense probably damaging 1.00
R5980:Sfrp5 UTSW 19 42201972 missense unknown
R6351:Sfrp5 UTSW 19 42201824 missense possibly damaging 0.91
R6702:Sfrp5 UTSW 19 42201827 missense probably benign 0.02
R6764:Sfrp5 UTSW 19 42199799 missense probably benign 0.00
R6836:Sfrp5 UTSW 19 42201710 missense probably damaging 0.97
R7024:Sfrp5 UTSW 19 42201765 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GCCCCATCCATCTTTTAGCAAG -3'
(R):5'- CTGTCCCTGCACTATATGAGC -3'

Sequencing Primer
(F):5'- CATCCATCTTTTAGCAAGCTAAGC -3'
(R):5'- CCTGCACTATATGAGCTCTTGAATTG -3'
Posted On2018-11-06