Incidental Mutation 'R6895:Usp31'
ID538284
Institutional Source Beutler Lab
Gene Symbol Usp31
Ensembl Gene ENSMUSG00000063317
Gene Nameubiquitin specific peptidase 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location121642021-121707253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121653176 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 747 (T747K)
Ref Sequence ENSEMBL: ENSMUSP00000040037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046929]
Predicted Effect probably benign
Transcript: ENSMUST00000046929
AA Change: T747K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040037
Gene: ENSMUSG00000063317
AA Change: T747K

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 29 58 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 90 120 N/A INTRINSIC
Pfam:UCH 122 755 2.5e-64 PFAM
Pfam:UCH_1 562 737 1.3e-12 PFAM
low complexity region 763 777 N/A INTRINSIC
low complexity region 792 811 N/A INTRINSIC
low complexity region 831 847 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
low complexity region 1009 1030 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1072 1127 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1192 1204 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Usp31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Usp31 APN 7 121706670 missense probably damaging 1.00
IGL00421:Usp31 APN 7 121648650 missense probably damaging 0.96
IGL00657:Usp31 APN 7 121648231 missense probably benign 0.00
IGL01917:Usp31 APN 7 121679485 missense probably benign 0.26
IGL02444:Usp31 APN 7 121679495 missense probably damaging 1.00
IGL03090:Usp31 APN 7 121679530 splice site probably benign
R0334:Usp31 UTSW 7 121658962 missense probably damaging 0.99
R0945:Usp31 UTSW 7 121670253 missense probably damaging 1.00
R1326:Usp31 UTSW 7 121648302 missense probably damaging 1.00
R2116:Usp31 UTSW 7 121648696 missense probably benign 0.39
R3113:Usp31 UTSW 7 121679513 missense probably damaging 1.00
R4072:Usp31 UTSW 7 121667782 splice site probably null
R4075:Usp31 UTSW 7 121667782 splice site probably null
R4076:Usp31 UTSW 7 121667782 splice site probably null
R4306:Usp31 UTSW 7 121706929 missense possibly damaging 0.93
R4675:Usp31 UTSW 7 121707325 unclassified probably benign
R4960:Usp31 UTSW 7 121648645 missense probably damaging 0.99
R5368:Usp31 UTSW 7 121661365 missense probably damaging 1.00
R5396:Usp31 UTSW 7 121667782 splice site probably null
R5456:Usp31 UTSW 7 121670277 missense probably damaging 1.00
R5475:Usp31 UTSW 7 121651526 missense probably damaging 1.00
R5497:Usp31 UTSW 7 121651601 missense probably damaging 1.00
R5872:Usp31 UTSW 7 121649475 missense probably benign 0.05
R6301:Usp31 UTSW 7 121648276 missense possibly damaging 0.76
R6688:Usp31 UTSW 7 121678330 missense probably benign 0.01
R6875:Usp31 UTSW 7 121649640 nonsense probably null
X0062:Usp31 UTSW 7 121651514 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGTCCACCCAAACTTCCTTG -3'
(R):5'- ATCCTGCCTGGGTATAAGTTG -3'

Sequencing Primer
(F):5'- CCTTGACTGAAATTATATCAGAGCCC -3'
(R):5'- CCTGCCTGGGTATAAGTTGAAATTTG -3'
Posted On2018-11-06