Mutagenetix > Incidental Mutation

Incidental Mutation 'R6895:Grid2'

538280

Institutional Source

Beutler Lab

Gene Symbol

Grid2

Ensembl Gene

ENSMUSG00000071424

Gene Name

glutamate receptor, ionotropic, delta 2

Synonyms

tpr, B230104L07Rik, GluRdelta2

MMRRC Submission

044989-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6895 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63232860-64681307 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64372283 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 655 (F655S)

Ref Sequence

ENSEMBL: ENSMUSP00000093536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095852]

AlphaFold

Q61625

Predicted Effect

probably damaging
Transcript: ENSMUST00000095852
AA Change: F655S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: F655S

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd29	A	G	18: 12,394,046 (GRCm39)	V256A	probably benign	Het
Arid4a	A	G	12: 71,110,076 (GRCm39)	D139G	probably benign	Het
AU040320	T	C	4: 126,685,723 (GRCm39)	W100R	probably damaging	Het
C4bp	T	C	1: 130,563,943 (GRCm39)	*470W	probably null	Het
Capn8	C	A	1: 182,456,234 (GRCm39)	D661E	possibly damaging	Het
Car14	T	C	3: 95,805,472 (GRCm39)	T334A	probably benign	Het
Cfhr4	G	A	1: 139,668,210 (GRCm39)	P308S	possibly damaging	Het
Chd6	T	A	2: 160,830,260 (GRCm39)	T1012S	probably damaging	Het
Csmd3	T	C	15: 47,529,910 (GRCm39)		probably null	Het
Dnaaf2	A	G	12: 69,244,437 (GRCm39)	V208A	probably benign	Het
Dnah11	A	G	12: 117,958,926 (GRCm39)	W2986R	probably damaging	Het
Epb42	G	A	2: 120,867,104 (GRCm39)		probably benign	Het
Fam120a	A	G	13: 49,045,497 (GRCm39)	F780L	probably benign	Het
Gpt2	G	A	8: 86,244,681 (GRCm39)	E325K	probably benign	Het
Homer3	T	C	8: 70,737,955 (GRCm39)	S2P	probably damaging	Het
Hydin	T	C	8: 111,038,883 (GRCm39)	V207A	probably benign	Het
Inpp5j	T	C	11: 3,445,557 (GRCm39)		probably null	Het
Jak1	C	T	4: 101,011,734 (GRCm39)		probably null	Het
Jmjd1c	A	G	10: 67,052,869 (GRCm39)	I220V	probably benign	Het
Kat6a	T	G	8: 23,425,799 (GRCm39)	S1115A	possibly damaging	Het
Larp4	T	G	15: 99,905,611 (GRCm39)		probably null	Het
Lrrc72	T	G	12: 36,259,717 (GRCm39)	D43A	probably damaging	Het
Mptx2	A	C	1: 173,105,252 (GRCm39)	V13G	probably benign	Het
Nmbr	A	T	10: 14,645,704 (GRCm39)	*258Y	probably null	Het
Nup210l	C	T	3: 90,067,231 (GRCm39)	A757V	probably damaging	Het
Nup62	A	G	7: 44,479,157 (GRCm39)	K391E	possibly damaging	Het
Nup93	T	A	8: 94,970,314 (GRCm39)	I71K	probably damaging	Het
Or14a256	A	T	7: 86,265,323 (GRCm39)	C177S	probably damaging	Het
Or8b51	A	C	9: 38,569,385 (GRCm39)	L101R	probably damaging	Het
Pik3cg	A	G	12: 32,254,346 (GRCm39)	M547T	possibly damaging	Het
Ropn1	A	T	16: 34,497,668 (GRCm39)	I187F	possibly damaging	Het
Rtp3	T	C	9: 110,816,264 (GRCm39)	R96G	possibly damaging	Het
Sfrp5	A	T	19: 42,188,227 (GRCm39)	S197R	probably damaging	Het
Slc12a6	A	G	2: 112,185,440 (GRCm39)	H903R	probably damaging	Het
Slc26a3	G	T	12: 31,513,523 (GRCm39)	A482S	probably damaging	Het
Slc2a12	G	T	10: 22,568,084 (GRCm39)	A504S	probably damaging	Het
Slitrk5	C	A	14: 111,919,085 (GRCm39)	P903Q	probably damaging	Het
Tas2r123	A	T	6: 132,824,133 (GRCm39)	H10L	probably benign	Het
Tex46	T	C	4: 136,340,212 (GRCm39)	V99A	probably benign	Het
Top2b	T	C	14: 16,413,604 (GRCm38)	V1024A	probably benign	Het
Ugt2b36	G	A	5: 87,240,157 (GRCm39)	T76I	probably benign	Het
Usp31	G	T	7: 121,252,399 (GRCm39)	T747K	probably benign	Het
Vmn2r111	T	C	17: 22,778,032 (GRCm39)	N549S	possibly damaging	Het

Other mutations in Grid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Grid2	APN	6	64,322,573 (GRCm39)	missense	probably damaging	1.00
IGL00596:Grid2	APN	6	64,510,688 (GRCm39)	missense	possibly damaging	0.93
IGL01686:Grid2	APN	6	64,297,180 (GRCm39)	missense	probably benign	0.00
IGL01712:Grid2	APN	6	64,642,899 (GRCm39)	missense	possibly damaging	0.73
IGL02064:Grid2	APN	6	64,040,919 (GRCm39)	missense	probably benign	0.29
IGL02216:Grid2	APN	6	64,322,650 (GRCm39)	missense	probably damaging	0.96
IGL02563:Grid2	APN	6	64,322,857 (GRCm39)	missense	possibly damaging	0.94
IGL02685:Grid2	APN	6	64,322,800 (GRCm39)	missense	possibly damaging	0.50
IGL03129:Grid2	APN	6	64,040,888 (GRCm39)	missense	probably damaging	0.98
IGL03324:Grid2	APN	6	64,406,806 (GRCm39)	missense	possibly damaging	0.88
IGL03395:Grid2	APN	6	63,886,053 (GRCm39)	missense	possibly damaging	0.94
crawler	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
swagger	UTSW	6	64,372,263 (GRCm39)	synonymous	probably benign
R0133:Grid2	UTSW	6	64,297,116 (GRCm39)	missense	probably damaging	1.00
R0147:Grid2	UTSW	6	64,510,571 (GRCm39)	missense	probably benign
R0193:Grid2	UTSW	6	64,040,937 (GRCm39)	missense	possibly damaging	0.64
R0370:Grid2	UTSW	6	64,322,718 (GRCm39)	missense	possibly damaging	0.75
R0399:Grid2	UTSW	6	64,643,036 (GRCm39)	missense	probably benign	0.33
R0600:Grid2	UTSW	6	63,480,419 (GRCm39)	missense	probably benign	0.38
R0717:Grid2	UTSW	6	64,643,259 (GRCm39)	missense	possibly damaging	0.96
R1524:Grid2	UTSW	6	64,406,738 (GRCm39)	missense	possibly damaging	0.92
R1555:Grid2	UTSW	6	64,406,668 (GRCm39)	missense	possibly damaging	0.87
R1572:Grid2	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
R1762:Grid2	UTSW	6	64,510,638 (GRCm39)	missense	probably damaging	0.98
R1944:Grid2	UTSW	6	63,886,045 (GRCm39)	missense	probably damaging	1.00
R1961:Grid2	UTSW	6	63,885,877 (GRCm39)	missense	probably damaging	1.00
R1969:Grid2	UTSW	6	63,885,902 (GRCm39)	nonsense	probably null
R2138:Grid2	UTSW	6	64,322,782 (GRCm39)	missense	probably damaging	0.99
R3500:Grid2	UTSW	6	63,480,383 (GRCm39)	missense	probably damaging	0.97
R3547:Grid2	UTSW	6	64,297,005 (GRCm39)	missense	probably damaging	0.97
R3845:Grid2	UTSW	6	64,322,826 (GRCm39)	missense	possibly damaging	0.62
R4124:Grid2	UTSW	6	63,480,417 (GRCm39)	missense	probably benign	0.41
R4273:Grid2	UTSW	6	63,886,029 (GRCm39)	missense	probably damaging	1.00
R4591:Grid2	UTSW	6	64,297,086 (GRCm39)	missense	probably damaging	1.00
R4701:Grid2	UTSW	6	64,642,899 (GRCm39)	missense	probably benign	0.27
R4721:Grid2	UTSW	6	64,643,185 (GRCm39)	missense	probably benign	0.33
R4755:Grid2	UTSW	6	63,885,972 (GRCm39)	missense	probably benign	0.04
R4869:Grid2	UTSW	6	64,406,724 (GRCm39)	missense	probably damaging	1.00
R5083:Grid2	UTSW	6	64,297,136 (GRCm39)	nonsense	probably null
R5091:Grid2	UTSW	6	64,053,862 (GRCm39)	missense	probably benign	0.07
R5117:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R5128:Grid2	UTSW	6	64,642,982 (GRCm39)	missense	probably benign	0.01
R5386:Grid2	UTSW	6	63,908,089 (GRCm39)	missense	probably damaging	0.99
R5404:Grid2	UTSW	6	63,907,894 (GRCm39)	missense	probably damaging	0.99
R5534:Grid2	UTSW	6	63,480,345 (GRCm39)	missense	probably benign
R5626:Grid2	UTSW	6	64,053,929 (GRCm39)	critical splice donor site	probably null
R5699:Grid2	UTSW	6	63,885,975 (GRCm39)	missense	probably damaging	0.99
R5700:Grid2	UTSW	6	64,071,416 (GRCm39)	missense	possibly damaging	0.95
R5876:Grid2	UTSW	6	64,640,146 (GRCm39)	missense	probably damaging	1.00
R6446:Grid2	UTSW	6	64,322,577 (GRCm39)	missense	probably damaging	1.00
R6694:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6697:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6699:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6767:Grid2	UTSW	6	63,907,999 (GRCm39)	missense	probably benign	0.01
R6999:Grid2	UTSW	6	64,053,893 (GRCm39)	missense	possibly damaging	0.80
R7053:Grid2	UTSW	6	64,677,402 (GRCm39)	missense	unknown
R7126:Grid2	UTSW	6	64,053,794 (GRCm39)	missense	probably damaging	0.99
R7432:Grid2	UTSW	6	64,252,854 (GRCm39)	missense	possibly damaging	0.46
R7553:Grid2	UTSW	6	64,053,925 (GRCm39)	missense	possibly damaging	0.95
R7619:Grid2	UTSW	6	63,908,085 (GRCm39)	missense	possibly damaging	0.71
R7997:Grid2	UTSW	6	64,297,120 (GRCm39)	missense	possibly damaging	0.89
R8112:Grid2	UTSW	6	63,885,891 (GRCm39)	missense	probably damaging	0.99
R8296:Grid2	UTSW	6	63,233,929 (GRCm39)	critical splice donor site	probably null
R8320:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R8467:Grid2	UTSW	6	64,510,635 (GRCm39)	missense	probably benign	0.01
R8691:Grid2	UTSW	6	63,480,321 (GRCm39)	missense	probably damaging	0.97
R8890:Grid2	UTSW	6	63,233,923 (GRCm39)	missense	probably benign
R8965:Grid2	UTSW	6	64,296,990 (GRCm39)	missense	probably damaging	1.00
R8968:Grid2	UTSW	6	64,643,139 (GRCm39)	missense	probably benign	0.14
R9220:Grid2	UTSW	6	63,885,888 (GRCm39)	missense	probably damaging	1.00
R9371:Grid2	UTSW	6	64,677,506 (GRCm39)	missense	unknown
R9653:Grid2	UTSW	6	63,907,968 (GRCm39)	missense	possibly damaging	0.75
Z1176:Grid2	UTSW	6	64,640,212 (GRCm39)	missense	probably benign	0.03
Z1176:Grid2	UTSW	6	63,885,863 (GRCm39)	missense	possibly damaging	0.76
Z1177:Grid2	UTSW	6	64,322,841 (GRCm39)	missense	probably damaging	1.00
Z1177:Grid2	UTSW	6	64,322,840 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAGGGAAACGTTTCTTGTTGTC -3'
(R):5'- CTGCCCTGACATAGCTATCC -3'

Sequencing Primer
(F):5'- TGTCTGTCTTGGCACTGAATG -3'
(R):5'- CCTGACATAGCTATCCTCTATGAAGG -3'

Posted On

2018-11-06