Incidental Mutation 'R0673:Lingo3'
ID61527
Institutional Source Beutler Lab
Gene Symbol Lingo3
Ensembl Gene ENSMUSG00000051067
Gene Nameleucine rich repeat and Ig domain containing 3
SynonymsLERN2
MMRRC Submission 038858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0673 (G1)
Quality Score94
Status Not validated
Chromosome10
Chromosomal Location80832801-80844039 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80835784 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 104 (R104L)
Ref Sequence ENSEMBL: ENSMUSP00000054960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053986] [ENSMUST00000219924]
Predicted Effect probably benign
Transcript: ENSMUST00000053986
AA Change: R104L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000054960
Gene: ENSMUSG00000051067
AA Change: R104L

DomainStartEndE-ValueType
LRRNT 23 57 1.54e-5 SMART
LRR_TYP 76 99 1.38e-3 SMART
LRR_TYP 100 123 4.94e-5 SMART
LRR 124 147 3.86e0 SMART
LRR 148 171 4.98e-1 SMART
LRR 172 195 1.62e1 SMART
LRR 246 267 3.46e2 SMART
LRR 269 291 3.86e0 SMART
LRR 292 315 3.24e0 SMART
LRR 316 339 4.34e-1 SMART
LRRCT 351 404 7.18e-3 SMART
IGc2 419 486 3.12e-14 SMART
transmembrane domain 526 548 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219924
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Ankrd13d A T 19: 4,273,019 probably null Het
Blm A T 7: 80,499,751 probably null Het
Caml C T 13: 55,631,828 T238M probably damaging Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Cxxc1 A G 18: 74,218,913 D287G possibly damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lgals9 A G 11: 78,965,853 F252L probably damaging Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nudt12 A T 17: 59,007,622 probably null Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Tmed8 A G 12: 87,174,104 V236A probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Yme1l1 T C 2: 23,168,288 F144S probably benign Het
Other mutations in Lingo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Lingo3 APN 10 80835313 missense probably damaging 1.00
IGL02120:Lingo3 APN 10 80835859 missense probably damaging 1.00
IGL02755:Lingo3 APN 10 80836009 missense possibly damaging 0.49
IGL02938:Lingo3 APN 10 80835154 missense probably benign 0.00
IGL02945:Lingo3 APN 10 80834698 missense probably damaging 1.00
IGL03167:Lingo3 APN 10 80835344 missense probably damaging 1.00
R0639:Lingo3 UTSW 10 80835784 missense probably benign 0.11
R0645:Lingo3 UTSW 10 80835335 missense probably benign 0.00
R1250:Lingo3 UTSW 10 80834771 missense probably benign 0.05
R1521:Lingo3 UTSW 10 80835721 missense probably benign
R1794:Lingo3 UTSW 10 80835598 missense probably benign 0.19
R4665:Lingo3 UTSW 10 80835538 missense probably damaging 1.00
R5587:Lingo3 UTSW 10 80835530 missense probably damaging 0.98
R6458:Lingo3 UTSW 10 80835316 missense probably damaging 1.00
R7082:Lingo3 UTSW 10 80835791 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATGAACACCAGGTCATTGTCGC -3'
(R):5'- TGGGTCAACGTCCTTGTGTCTAGC -3'

Sequencing Primer
(F):5'- AGGTCATTGTCGCCCACC -3'
(R):5'- CGTGGATACTGATAAAGTCTATCCCC -3'
Posted On2013-07-30