Incidental Mutation 'R0782:Olfr609'
ID76685
Institutional Source Beutler Lab
Gene Symbol Olfr609
Ensembl Gene ENSMUSG00000046396
Gene Nameolfactory receptor 609
SynonymsMOR9-1, GA_x6K02T2PBJ9-6207735-6206776
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0782 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103490025-103498062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 103492515 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 121 (R121L)
Ref Sequence ENSEMBL: ENSMUSP00000149804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055787] [ENSMUST00000216075] [ENSMUST00000216360]
Predicted Effect probably damaging
Transcript: ENSMUST00000055787
AA Change: R121L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051749
Gene: ENSMUSG00000046396
AA Change: R121L

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 1.4e-119 PFAM
Pfam:7TM_GPCR_Srsx 34 169 2.2e-10 PFAM
Pfam:7tm_1 40 291 3.6e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216075
AA Change: R121L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216360
AA Change: R121L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.466 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Olfr609
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02213:Olfr609 APN 7 103492488 missense probably benign 0.05
IGL02309:Olfr609 APN 7 103491999 missense probably damaging 0.99
R0988:Olfr609 UTSW 7 103492747 missense probably damaging 1.00
R4013:Olfr609 UTSW 7 103492633 missense probably benign
R4600:Olfr609 UTSW 7 103492581 missense probably damaging 0.99
R4735:Olfr609 UTSW 7 103492060 missense possibly damaging 0.61
R4941:Olfr609 UTSW 7 103492251 missense probably damaging 1.00
R5204:Olfr609 UTSW 7 103492540 missense probably damaging 1.00
R5281:Olfr609 UTSW 7 103491973 missense probably benign 0.00
R5941:Olfr609 UTSW 7 103492720 missense possibly damaging 0.95
R6319:Olfr609 UTSW 7 103492725 missense possibly damaging 0.84
R6505:Olfr609 UTSW 7 103492651 missense probably damaging 1.00
R7258:Olfr609 UTSW 7 103492589 missense probably damaging 1.00
X0065:Olfr609 UTSW 7 103491918 makesense probably null
Predicted Primers PCR Primer
(F):5'- CGCTTCTGGCAGTAAGGTAGCTTC -3'
(R):5'- TGAGACAGTGTATCTCTGGCTCTCC -3'

Sequencing Primer
(F):5'- GCAGTAAGGTAGCTTCTTCAGC -3'
(R):5'- GTTGTAAAGTCAGAGCCCTCC -3'
Posted On2013-10-16