Incidental Mutation 'R0782:Serping1'
ID76670
Institutional Source Beutler Lab
Gene Symbol Serping1
Ensembl Gene ENSMUSG00000023224
Gene Nameserine (or cysteine) peptidase inhibitor, clade G, member 1
SynonymsC1INH, C1 inhibitor, C1nh
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R0782 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location84765387-84775444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84767446 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 364 (P364S)
Ref Sequence ENSEMBL: ENSMUSP00000023994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023994] [ENSMUST00000111641]
Predicted Effect probably damaging
Transcript: ENSMUST00000023994
AA Change: P364S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023994
Gene: ENSMUSG00000023224
AA Change: P364S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 156 502 3.26e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111641
SMART Domains Protein: ENSMUSP00000107268
Gene: ENSMUSG00000023224

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 156 347 5.39e-6 SMART
Meta Mutation Damage Score 0.646 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly glycosylated plasma protein involved in the regulation of the complement cascade. Its protein inhibits activated C1r and C1s of the first complement component and thus regulates complement activation. Deficiency of this protein is associated with hereditary angioneurotic oedema (HANE). Alternative splicing results in multiple transcript variants encoding the same isoform. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice exhibit an increased vascular permeability compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cspp1 T A 1: 10,129,974 probably benign Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Serping1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Serping1 APN 2 84770185 missense probably damaging 1.00
IGL01791:Serping1 APN 2 84773377 missense possibly damaging 0.68
IGL01903:Serping1 APN 2 84769772 critical splice donor site probably null
IGL03182:Serping1 APN 2 84765818 missense probably damaging 1.00
R0094:Serping1 UTSW 2 84773276 missense probably benign 0.00
R0548:Serping1 UTSW 2 84770081 splice site probably benign
R1585:Serping1 UTSW 2 84771504 missense probably benign 0.33
R1900:Serping1 UTSW 2 84771449 missense probably damaging 0.99
R1965:Serping1 UTSW 2 84765728 missense probably damaging 1.00
R1966:Serping1 UTSW 2 84765728 missense probably damaging 1.00
R2252:Serping1 UTSW 2 84769851 missense probably damaging 0.99
R2426:Serping1 UTSW 2 84770219 missense probably damaging 0.99
R4997:Serping1 UTSW 2 84770285 missense possibly damaging 0.74
R5665:Serping1 UTSW 2 84771545 missense probably damaging 0.99
R6192:Serping1 UTSW 2 84770268 missense possibly damaging 0.93
R6866:Serping1 UTSW 2 84770233 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TGATAGCCGCATTTTAGCACCACC -3'
(R):5'- ACCAGGACCAGCATACTTCAGTCAG -3'

Sequencing Primer
(F):5'- CCGGGGAGTAACCACAAGTG -3'
(R):5'- AGTCAGCTTGACTGGCAC -3'
Posted On2013-10-16