Mutagenetix > Incidental Mutation

Incidental Mutation 'R1210:Mme'

100637

Institutional Source

Beutler Lab

Gene Symbol

Mme

Ensembl Gene

ENSMUSG00000027820

Gene Name

membrane metallo endopeptidase

Synonyms

neprilysin, 6030454K05Rik, neutral endopeptidase, NEP, CD10

MMRRC Submission

039279-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1210 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63202632-63291134 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63251027 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 356 (K356R)

Ref Sequence

ENSEMBL: ENSMUSP00000141544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000194134] [ENSMUST00000194150]

AlphaFold

Q61391

Predicted Effect

probably benign
Transcript: ENSMUST00000029400
AA Change: K356R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: K356R

Domain	Start	End	E-Value	Type
PDB:2YVC\|F	2	23	5e-7	PDB
transmembrane domain	29	51	N/A	INTRINSIC
Pfam:Peptidase_M13_N	80	483	8.7e-103	PFAM
low complexity region	489	507	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC
Pfam:Peptidase_M13	543	749	5.8e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193805

Predicted Effect

probably benign
Transcript: ENSMUST00000194134
AA Change: K356R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: K356R

Domain	Start	End	E-Value	Type
PDB:2YVC\|F	2	23	5e-7	PDB
transmembrane domain	29	51	N/A	INTRINSIC
Pfam:Peptidase_M13_N	80	483	8.4e-134	PFAM
low complexity region	489	507	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC
Pfam:Peptidase_M13	543	749	3.3e-67	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000194150
AA Change: K356R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: K356R

Domain	Start	End	E-Value	Type
PDB:2YVC\|F	2	23	5e-7	PDB
transmembrane domain	29	51	N/A	INTRINSIC
Pfam:Peptidase_M13_N	80	483	8.4e-134	PFAM
low complexity region	489	507	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC
Pfam:Peptidase_M13	543	749	3.3e-67	PFAM

Coding Region Coverage

1x: 99.1%
3x: 97.8%
10x: 93.9%
20x: 83.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cdh15	G	C	8: 123,584,234 (GRCm39)	E112Q	probably damaging	Het
Clec7a	T	C	6: 129,442,488 (GRCm39)	I180V	probably damaging	Het
Csf3	A	G	11: 98,593,303 (GRCm39)	D140G	probably damaging	Het
Cwf19l2	T	C	9: 3,430,810 (GRCm39)	S381P	probably benign	Het
Eef1b2	A	G	1: 63,216,432 (GRCm39)	D21G	probably damaging	Het
Fam83a	A	T	15: 57,858,644 (GRCm39)	Y228F	possibly damaging	Het
Gm5422	A	G	10: 31,126,719 (GRCm39)		noncoding transcript	Het
Itga5	A	G	15: 103,265,900 (GRCm39)	V149A	possibly damaging	Het
Lrrfip1	A	G	1: 91,042,915 (GRCm39)	H440R	probably benign	Het
Mfsd13a	C	T	19: 46,354,943 (GRCm39)	T40I	probably benign	Het
Mindy4	T	A	6: 55,261,798 (GRCm39)	L569H	possibly damaging	Het
Nfkb1	A	G	3: 135,300,688 (GRCm39)	I626T	probably benign	Het
Or2f1b	T	C	6: 42,739,601 (GRCm39)	V205A	possibly damaging	Het
Or2t6	T	C	14: 14,176,029 (GRCm38)	T18A	probably benign	Het
Or4c100	G	C	2: 88,356,620 (GRCm39)	R231P	possibly damaging	Het
Or5k1b	T	C	16: 58,581,413 (GRCm39)	N42S	probably damaging	Het
Rock2	T	A	12: 17,015,470 (GRCm39)	V789D	probably damaging	Het
Sav1	A	G	12: 70,015,953 (GRCm39)	Y282H	probably damaging	Het
Ugcg	C	T	4: 59,207,798 (GRCm39)	P46S	probably benign	Het
Vmn2r89	T	C	14: 51,692,427 (GRCm39)	F77L	probably benign	Het
Vps50	G	A	6: 3,594,884 (GRCm39)	V816I	probably damaging	Het

Other mutations in Mme

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Mme	APN	3	63,247,465 (GRCm39)	missense	possibly damaging	0.95
IGL00329:Mme	APN	3	63,287,749 (GRCm39)	nonsense	probably null
IGL01013:Mme	APN	3	63,235,281 (GRCm39)	splice site	probably null
IGL01316:Mme	APN	3	63,247,580 (GRCm39)	splice site	probably benign
IGL01333:Mme	APN	3	63,253,512 (GRCm39)	missense	probably damaging	1.00
IGL01392:Mme	APN	3	63,269,467 (GRCm39)	missense	probably damaging	1.00
IGL01566:Mme	APN	3	63,269,350 (GRCm39)	splice site	probably benign
IGL01739:Mme	APN	3	63,247,534 (GRCm39)	missense	possibly damaging	0.78
IGL01996:Mme	APN	3	63,250,970 (GRCm39)	missense	probably benign	0.11
IGL02125:Mme	APN	3	63,256,070 (GRCm39)	missense	probably damaging	1.00
IGL02154:Mme	APN	3	63,250,976 (GRCm39)	missense	probably benign
IGL03214:Mme	APN	3	63,237,111 (GRCm39)	missense	possibly damaging	0.72
IGL03291:Mme	APN	3	63,253,525 (GRCm39)	missense	probably benign	0.00
R0498:Mme	UTSW	3	63,253,487 (GRCm39)	missense	probably damaging	1.00
R0595:Mme	UTSW	3	63,235,602 (GRCm39)	missense	probably benign	0.27
R0980:Mme	UTSW	3	63,247,550 (GRCm39)	missense	probably benign
R1600:Mme	UTSW	3	63,272,479 (GRCm39)	missense	probably damaging	1.00
R1852:Mme	UTSW	3	63,235,467 (GRCm39)	missense	probably benign	0.00
R1852:Mme	UTSW	3	63,235,404 (GRCm39)	missense	probably benign	0.31
R2037:Mme	UTSW	3	63,235,681 (GRCm39)	missense	probably null	1.00
R2177:Mme	UTSW	3	63,208,426 (GRCm39)	missense	probably benign	0.02
R2200:Mme	UTSW	3	63,287,713 (GRCm39)	missense	possibly damaging	0.87
R2306:Mme	UTSW	3	63,207,673 (GRCm39)	missense	probably benign	0.00
R2847:Mme	UTSW	3	63,252,620 (GRCm39)	missense	possibly damaging	0.91
R3008:Mme	UTSW	3	63,266,378 (GRCm39)	missense	probably damaging	1.00
R3749:Mme	UTSW	3	63,250,961 (GRCm39)	missense	probably damaging	1.00
R3876:Mme	UTSW	3	63,269,480 (GRCm39)	splice site	probably benign
R3961:Mme	UTSW	3	63,252,613 (GRCm39)	missense	probably damaging	1.00
R3981:Mme	UTSW	3	63,235,485 (GRCm39)	missense	probably damaging	1.00
R3982:Mme	UTSW	3	63,235,485 (GRCm39)	missense	probably damaging	1.00
R3983:Mme	UTSW	3	63,235,485 (GRCm39)	missense	probably damaging	1.00
R4494:Mme	UTSW	3	63,254,613 (GRCm39)	missense	probably benign
R4589:Mme	UTSW	3	63,287,693 (GRCm39)	missense	probably benign
R4706:Mme	UTSW	3	63,256,133 (GRCm39)	missense	possibly damaging	0.92
R4871:Mme	UTSW	3	63,247,453 (GRCm39)	missense	probably benign	0.01
R4957:Mme	UTSW	3	63,250,910 (GRCm39)	splice site	probably benign
R5053:Mme	UTSW	3	63,272,270 (GRCm39)	missense	probably damaging	1.00
R5316:Mme	UTSW	3	63,276,375 (GRCm39)	missense	probably damaging	1.00
R5502:Mme	UTSW	3	63,207,702 (GRCm39)	nonsense	probably null
R5579:Mme	UTSW	3	63,256,066 (GRCm39)	missense	probably damaging	1.00
R6007:Mme	UTSW	3	63,250,929 (GRCm39)	nonsense	probably null
R6022:Mme	UTSW	3	63,272,218 (GRCm39)	missense	probably damaging	1.00
R6143:Mme	UTSW	3	63,207,532 (GRCm39)	splice site	probably null
R6154:Mme	UTSW	3	63,207,674 (GRCm39)	missense	probably damaging	0.98
R6333:Mme	UTSW	3	63,249,382 (GRCm39)	missense	probably benign	0.00
R6476:Mme	UTSW	3	63,251,056 (GRCm39)	critical splice donor site	probably null
R6514:Mme	UTSW	3	63,272,265 (GRCm39)	nonsense	probably null
R6711:Mme	UTSW	3	63,249,339 (GRCm39)	missense	possibly damaging	0.93
R6842:Mme	UTSW	3	63,269,465 (GRCm39)	missense	probably damaging	1.00
R6996:Mme	UTSW	3	63,253,523 (GRCm39)	missense	possibly damaging	0.63
R7040:Mme	UTSW	3	63,276,344 (GRCm39)	missense	probably damaging	1.00
R7043:Mme	UTSW	3	63,252,638 (GRCm39)	nonsense	probably null
R7084:Mme	UTSW	3	63,235,638 (GRCm39)	missense	probably damaging	0.98
R7126:Mme	UTSW	3	63,276,322 (GRCm39)	missense	probably damaging	0.97
R7783:Mme	UTSW	3	63,272,288 (GRCm39)	missense	probably damaging	1.00
R8501:Mme	UTSW	3	63,234,156 (GRCm39)	missense	probably damaging	1.00
R8857:Mme	UTSW	3	63,256,070 (GRCm39)	missense	probably damaging	1.00
R9453:Mme	UTSW	3	63,272,306 (GRCm39)	missense	possibly damaging	0.90
R9556:Mme	UTSW	3	63,272,225 (GRCm39)	missense	probably damaging	0.97
R9648:Mme	UTSW	3	63,208,426 (GRCm39)	missense	probably benign	0.02
X0058:Mme	UTSW	3	63,272,442 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGATGCCCTATAGTGTGTGAACTTC -3'
(R):5'- ACCTTGCGGAAAGCATTTCTGGAC -3'

Sequencing Primer
(F):5'- CCCTATAGTGTGTGAACTTCTAACC -3'
(R):5'- TGAGGCTGCTTACAAGATCC -3'

Posted On

2014-01-15