Incidental Mutation 'R1281:Csnk1e'
ID151036
Institutional Source Beutler Lab
Gene Symbol Csnk1e
Ensembl Gene ENSMUSG00000022433
Gene Namecasein kinase 1, epsilon
SynonymsCKIepsilon, KC1epsilon, CKI epsilon, CK1epsilon, tau
MMRRC Submission 039347-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1281 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79417856-79455566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 79420641 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 387 (N387K)
Ref Sequence ENSEMBL: ENSMUSP00000113975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117786] [ENSMUST00000120859] [ENSMUST00000122044]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117786
AA Change: N387K

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113341
Gene: ENSMUSG00000022433
AA Change: N387K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 8.7e-18 PFAM
Pfam:Pkinase 9 277 5.2e-28 PFAM
low complexity region 306 316 N/A INTRINSIC
low complexity region 329 338 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120859
AA Change: N387K

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113975
Gene: ENSMUSG00000022433
AA Change: N387K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 9.8e-18 PFAM
Pfam:Pkinase 9 280 7e-40 PFAM
low complexity region 306 316 N/A INTRINSIC
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122044
SMART Domains Protein: ENSMUSP00000113096
Gene: ENSMUSG00000022433

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 7.9e-18 PFAM
Pfam:Pkinase 9 280 5.7e-40 PFAM
low complexity region 309 324 N/A INTRINSIC
low complexity region 345 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156513
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit disruptions in circadian rhythms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 A T 1: 173,459,811 K126* probably null Het
C9 A T 15: 6,489,840 N386I possibly damaging Het
Cul9 T C 17: 46,511,534 T1758A probably damaging Het
Dcaf17 A G 2: 71,078,156 I256V probably damaging Het
Duox1 G A 2: 122,327,088 C565Y probably damaging Het
Fchsd2 A G 7: 101,253,552 H379R possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Krt2 C A 15: 101,813,292 C438F probably damaging Het
Mast4 G A 13: 102,750,578 T1001I probably damaging Het
Mrc1 T C 2: 14,293,510 F726L probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Mttp T C 3: 138,107,219 N550S possibly damaging Het
Necap1 G T 6: 122,874,614 D16Y possibly damaging Het
Nox3 A T 17: 3,696,185 I26N probably damaging Het
Patj T C 4: 98,416,695 I262T probably damaging Het
Pcdh8 T C 14: 79,767,726 E953G probably damaging Het
Pirb A T 7: 3,717,190 C395S probably damaging Het
Sacs A G 14: 61,191,801 I433M probably benign Het
Sclt1 A G 3: 41,647,620 F552L probably benign Het
Smc5 T C 19: 23,235,883 N479S probably benign Het
Tg G A 15: 66,696,489 V1342I probably benign Het
Ube2n C A 10: 95,541,756 N132K probably benign Het
Vmn2r55 A T 7: 12,670,898 C193S probably benign Het
Zc3hav1 A G 6: 38,353,937 C96R probably damaging Het
Zfp60 T A 7: 27,738,427 V53E probably damaging Het
Other mutations in Csnk1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0624:Csnk1e UTSW 15 79419898 unclassified probably benign
R1618:Csnk1e UTSW 15 79424850 missense probably benign 0.02
R3005:Csnk1e UTSW 15 79438805 missense probably benign 0.42
R4241:Csnk1e UTSW 15 79424895 missense probably damaging 1.00
R4242:Csnk1e UTSW 15 79424895 missense probably damaging 1.00
R4276:Csnk1e UTSW 15 79429767 missense probably damaging 1.00
R4438:Csnk1e UTSW 15 79420929 missense probably benign 0.08
R4994:Csnk1e UTSW 15 79424929 missense probably damaging 1.00
R5071:Csnk1e UTSW 15 79420872 nonsense probably null
R7072:Csnk1e UTSW 15 79438767 splice site probably null
R7553:Csnk1e UTSW 15 79426366 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATTAAGTGGGATGACCTGAC -3'
(R):5'- TTGCAATGAAGCACCCTCCCTG -3'

Sequencing Primer
(F):5'- TTCGCTTTGCTCAACACAAGAG -3'
(R):5'- ATCCCGAGGATGTAGACCG -3'
Posted On2014-01-29