Incidental Mutation 'R1254:Vmn1r7'
ID151384
Institutional Source Beutler Lab
Gene Symbol Vmn1r7
Ensembl Gene ENSMUSG00000093696
Gene Namevomeronasal 1 receptor 7
SynonymsGm5568, V1rc31
MMRRC Submission 039321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R1254 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location57024106-57025324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57024787 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 163 (C163R)
Ref Sequence ENSEMBL: ENSMUSP00000135571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176252]
Predicted Effect probably damaging
Transcript: ENSMUST00000176252
AA Change: C163R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135571
Gene: ENSMUSG00000093696
AA Change: C163R

DomainStartEndE-ValueType
Pfam:V1R 28 293 1.1e-59 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Coro2b A G 9: 62,428,965 L280P probably damaging Het
D430041D05Rik T G 2: 104,201,303 K1649N probably damaging Het
Duox2 T A 2: 122,283,478 H1191L probably damaging Het
Etl4 A G 2: 20,807,923 T1430A probably damaging Het
Hivep3 A G 4: 120,099,293 Y1602C probably damaging Het
Ints6 A G 14: 62,716,374 S180P probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Klhdc3 C T 17: 46,678,067 V66I probably benign Het
Olfr477 T A 7: 107,990,440 V25D probably benign Het
Pank1 T C 19: 34,840,860 H93R probably benign Het
Pcdhb16 T G 18: 37,479,295 V436G possibly damaging Het
Plekha6 G A 1: 133,272,589 R302H probably benign Het
Ptk2 C T 15: 73,229,970 R797Q probably benign Het
Rnase10 A T 14: 51,009,626 M117L probably damaging Het
Rnf151 A T 17: 24,717,552 C20* probably null Het
Robo4 T C 9: 37,410,840 probably null Het
Rps6ka5 G T 12: 100,619,529 H168Q probably damaging Het
Sstr1 G A 12: 58,213,322 V244M possibly damaging Het
Tmem147 A T 7: 30,729,370 Y17* probably null Het
Other mutations in Vmn1r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Vmn1r7 APN 6 57024723 missense probably damaging 1.00
IGL01528:Vmn1r7 APN 6 57024547 missense probably benign
IGL02024:Vmn1r7 APN 6 57024889 missense probably benign 0.01
IGL02234:Vmn1r7 APN 6 57024552 missense probably damaging 0.98
IGL02610:Vmn1r7 APN 6 57025052 missense probably benign 0.01
IGL02691:Vmn1r7 APN 6 57024388 missense probably benign 0.05
R0529:Vmn1r7 UTSW 6 57024465 missense possibly damaging 0.78
R0548:Vmn1r7 UTSW 6 57025081 missense probably damaging 0.96
R1279:Vmn1r7 UTSW 6 57024949 missense possibly damaging 0.63
R1582:Vmn1r7 UTSW 6 57025158 missense probably damaging 1.00
R1973:Vmn1r7 UTSW 6 57025026 missense probably benign 0.00
R1991:Vmn1r7 UTSW 6 57024868 missense probably benign 0.37
R2160:Vmn1r7 UTSW 6 57024894 missense probably damaging 0.97
R3546:Vmn1r7 UTSW 6 57024849 missense possibly damaging 0.80
R3547:Vmn1r7 UTSW 6 57024849 missense possibly damaging 0.80
R5901:Vmn1r7 UTSW 6 57024606 missense probably damaging 1.00
R6294:Vmn1r7 UTSW 6 57024419 missense probably benign 0.00
R7063:Vmn1r7 UTSW 6 57024433 missense possibly damaging 0.63
R7192:Vmn1r7 UTSW 6 57024467 missense probably benign 0.00
R7647:Vmn1r7 UTSW 6 57025270 missense probably benign 0.01
R7781:Vmn1r7 UTSW 6 57024568 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTATGAAGATGCTTGCATTGCCTC -3'
(R):5'- AGACCTGATCTCCTGTCAACTGTCC -3'

Sequencing Primer
(F):5'- TGCCTCTGATGCCTGAACAAG -3'
(R):5'- CTACTTATTCAGAGTGATGAGAGGC -3'
Posted On2014-01-29