Incidental Mutation 'R1225:Prickle4'
ID152889
Institutional Source Beutler Lab
Gene Symbol Prickle4
Ensembl Gene ENSMUSG00000096549
Gene Nameprickle planar cell polarity protein 4
SynonymsLOC381104
MMRRC Submission 039294-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1225 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location47688517-47694736 bp(-) (GRCm38)
Type of Mutationunclassified (1951 bp from exon)
DNA Base Change (assembly) T to G at 47688689 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024779] [ENSMUST00000113299] [ENSMUST00000113300] [ENSMUST00000113301] [ENSMUST00000113302] [ENSMUST00000132397] [ENSMUST00000143789] [ENSMUST00000156118]
Predicted Effect probably null
Transcript: ENSMUST00000024779
SMART Domains Protein: ENSMUSP00000024779
Gene: ENSMUSG00000090115

DomainStartEndE-ValueType
ZnF_UBP 25 74 4.21e-17 SMART
coiled coil region 165 203 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
Pfam:UCH 249 651 5.4e-61 PFAM
Pfam:UCH_1 337 633 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113299
AA Change: Q273P

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108924
Gene: ENSMUSG00000096549
AA Change: Q273P

DomainStartEndE-ValueType
Pfam:PET 22 74 2.7e-13 PFAM
LIM 83 140 1.56e-7 SMART
LIM 148 200 1.28e-12 SMART
low complexity region 207 221 N/A INTRINSIC
low complexity region 282 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113300
AA Change: Q313P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000108925
Gene: ENSMUSG00000096549
AA Change: Q313P

DomainStartEndE-ValueType
Pfam:PET 62 114 6e-13 PFAM
LIM 123 180 1.56e-7 SMART
LIM 188 240 1.28e-12 SMART
low complexity region 247 261 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113301
SMART Domains Protein: ENSMUSP00000108926
Gene: ENSMUSG00000033475

DomainStartEndE-ValueType
Pfam:TOMM6 1 74 4.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113302
SMART Domains Protein: ENSMUSP00000108927
Gene: ENSMUSG00000033475

DomainStartEndE-ValueType
Pfam:TOM6p 1 74 5.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132397
SMART Domains Protein: ENSMUSP00000117658
Gene: ENSMUSG00000023984

DomainStartEndE-ValueType
Pfam:Med20 1 149 1.6e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143156
Predicted Effect probably benign
Transcript: ENSMUST00000143789
AA Change: Q313P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000119045
Gene: ENSMUSG00000079444
AA Change: Q313P

DomainStartEndE-ValueType
Pfam:PET 66 116 8.6e-12 PFAM
LIM 123 180 1.56e-7 SMART
LIM 188 240 1.28e-12 SMART
low complexity region 247 261 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151540
Predicted Effect probably benign
Transcript: ENSMUST00000152214
SMART Domains Protein: ENSMUSP00000121465
Gene: ENSMUSG00000096549

DomainStartEndE-ValueType
Pfam:PET 3 50 7.4e-14 PFAM
LIM 59 116 1.56e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155812
Predicted Effect probably benign
Transcript: ENSMUST00000156118
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C6ORF49 is a member of the LIM domain protein family (Teufel et al., 2005 [PubMed 15702247]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A T 9: 103,254,839 probably benign Het
A730013G03Rik T A 1: 192,833,645 noncoding transcript Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ahnak T A 19: 9,002,883 D510E probably damaging Het
Angptl4 C T 17: 33,781,191 A68T possibly damaging Het
Arid1a A G 4: 133,687,365 V1185A unknown Het
Atp2c2 C A 8: 119,735,245 Q286K probably damaging Het
Blzf1 T C 1: 164,299,596 E209G probably damaging Het
Bmp6 A G 13: 38,346,281 T117A probably benign Het
Cmip T C 8: 117,445,371 F394L probably damaging Het
Col6a3 T A 1: 90,811,516 D330V probably damaging Het
Crebbp A T 16: 4,126,956 S491R probably benign Het
Dedd G A 1: 171,340,295 probably null Het
Dennd4a A G 9: 64,911,675 H1704R probably benign Het
Dicer1 C T 12: 104,691,607 V1903I probably damaging Het
Dnah9 A G 11: 65,871,060 V3868A possibly damaging Het
Eif5b A G 1: 38,037,628 I674V probably damaging Het
F13a1 T C 13: 37,025,851 N47D probably benign Het
Fancd2 T C 6: 113,535,861 S53P probably damaging Het
Fsip1 C A 2: 118,248,350 L170F probably damaging Het
Git2 A T 5: 114,733,178 probably benign Het
Gm9742 T C 13: 8,029,839 noncoding transcript Het
Heatr4 C T 12: 83,978,046 E334K probably benign Het
Hoga1 T G 19: 42,070,189 V110G probably damaging Het
Ighv6-4 T A 12: 114,406,550 D75V probably damaging Het
Med15 G T 16: 17,722,788 S31R probably damaging Het
Nbeal2 T C 9: 110,632,886 E1467G probably damaging Het
Olfr201 T C 16: 59,269,224 T148A probably benign Het
Olfr705 A T 7: 106,714,524 D52E probably benign Het
Olfr720 T A 14: 14,175,600 I161F possibly damaging Het
Papss1 T C 3: 131,579,301 probably benign Het
Pde4d A T 13: 109,950,221 M610L probably benign Het
Sema3g A G 14: 31,220,679 Y79C probably damaging Het
Setbp1 T A 18: 78,858,208 D748V probably damaging Het
Slc46a2 A T 4: 59,914,125 V266E probably benign Het
Slc9a8 T C 2: 167,471,523 I435T probably benign Het
Snx29 T C 16: 11,420,686 probably benign Het
Son C T 16: 91,657,340 R992C probably damaging Het
Stxbp5 T C 10: 9,812,391 N389D possibly damaging Het
Vmn1r28 C T 6: 58,265,966 Q265* probably null Het
Other mutations in Prickle4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Prickle4 APN 17 47690249 missense probably damaging 0.99
R1867:Prickle4 UTSW 17 47690119 missense possibly damaging 0.88
R3950:Prickle4 UTSW 17 47688582 missense probably benign 0.04
R4328:Prickle4 UTSW 17 47688618 missense probably damaging 1.00
R4398:Prickle4 UTSW 17 47690531 intron probably benign
R4890:Prickle4 UTSW 17 47689881 intron probably benign
R5155:Prickle4 UTSW 17 47690057 critical splice donor site probably null
R5801:Prickle4 UTSW 17 47688773 missense possibly damaging 0.90
R6056:Prickle4 UTSW 17 47690210 missense probably damaging 1.00
R6528:Prickle4 UTSW 17 47689333 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCACAGCCTTGTTATCTCGCTAC -3'
(R):5'- AATTTCCCAGATCAGAACCCTTCGC -3'

Sequencing Primer
(F):5'- cccaccccaccccaatc -3'
(R):5'- CCTCTTGCACAAGGACTTGG -3'
Posted On2014-01-29