Incidental Mutation 'R4398:Prickle4'
ID325610
Institutional Source Beutler Lab
Gene Symbol Prickle4
Ensembl Gene ENSMUSG00000096549
Gene Nameprickle planar cell polarity protein 4
SynonymsLOC381104
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location47688517-47694736 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 47690531 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024779] [ENSMUST00000113296] [ENSMUST00000113299] [ENSMUST00000113300] [ENSMUST00000113301] [ENSMUST00000113302] [ENSMUST00000143789] [ENSMUST00000156118]
Predicted Effect probably benign
Transcript: ENSMUST00000024779
SMART Domains Protein: ENSMUSP00000024779
Gene: ENSMUSG00000090115

DomainStartEndE-ValueType
ZnF_UBP 25 74 4.21e-17 SMART
coiled coil region 165 203 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
Pfam:UCH 249 651 5.4e-61 PFAM
Pfam:UCH_1 337 633 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113296
SMART Domains Protein: ENSMUSP00000108921
Gene: ENSMUSG00000023266

DomainStartEndE-ValueType
IRS 17 110 4.31e-33 SMART
PTBI 18 110 1.23e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113299
SMART Domains Protein: ENSMUSP00000108924
Gene: ENSMUSG00000096549

DomainStartEndE-ValueType
Pfam:PET 22 74 2.7e-13 PFAM
LIM 83 140 1.56e-7 SMART
LIM 148 200 1.28e-12 SMART
low complexity region 207 221 N/A INTRINSIC
low complexity region 282 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113300
SMART Domains Protein: ENSMUSP00000108925
Gene: ENSMUSG00000096549

DomainStartEndE-ValueType
Pfam:PET 62 114 6e-13 PFAM
LIM 123 180 1.56e-7 SMART
LIM 188 240 1.28e-12 SMART
low complexity region 247 261 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113301
SMART Domains Protein: ENSMUSP00000108926
Gene: ENSMUSG00000033475

DomainStartEndE-ValueType
Pfam:TOMM6 1 74 4.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113302
SMART Domains Protein: ENSMUSP00000108927
Gene: ENSMUSG00000033475

DomainStartEndE-ValueType
Pfam:TOM6p 1 74 5.2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143156
Predicted Effect probably benign
Transcript: ENSMUST00000143789
SMART Domains Protein: ENSMUSP00000119045
Gene: ENSMUSG00000079444

DomainStartEndE-ValueType
Pfam:PET 66 116 8.6e-12 PFAM
LIM 123 180 1.56e-7 SMART
LIM 188 240 1.28e-12 SMART
low complexity region 247 261 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151540
Predicted Effect probably benign
Transcript: ENSMUST00000152214
SMART Domains Protein: ENSMUSP00000121465
Gene: ENSMUSG00000096549

DomainStartEndE-ValueType
Pfam:PET 3 50 7.4e-14 PFAM
LIM 59 116 1.56e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155812
Predicted Effect probably benign
Transcript: ENSMUST00000156118
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C6ORF49 is a member of the LIM domain protein family (Teufel et al., 2005 [PubMed 15702247]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Prickle4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Prickle4 APN 17 47690249 missense probably damaging 0.99
R1225:Prickle4 UTSW 17 47688689 unclassified probably null
R1867:Prickle4 UTSW 17 47690119 missense possibly damaging 0.88
R3950:Prickle4 UTSW 17 47688582 missense probably benign 0.04
R4328:Prickle4 UTSW 17 47688618 missense probably damaging 1.00
R4890:Prickle4 UTSW 17 47689881 intron probably benign
R5155:Prickle4 UTSW 17 47690057 critical splice donor site probably null
R5801:Prickle4 UTSW 17 47688773 missense possibly damaging 0.90
R6056:Prickle4 UTSW 17 47690210 missense probably damaging 1.00
R6528:Prickle4 UTSW 17 47689333 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGATCAGAATCTGACGCTTCTC -3'
(R):5'- TCAGCAGGAACGCTACTGTC -3'

Sequencing Primer
(F):5'- AGAATCTGACGCTTCTCTTCTTAG -3'
(R):5'- AACGCTACTGTCTGGCCCTAG -3'
Posted On2015-07-06