Incidental Mutation 'R1347:Olfr444'
ID156533
Institutional Source Beutler Lab
Gene Symbol Olfr444
Ensembl Gene ENSMUSG00000073110
Gene Nameolfactory receptor 444
SynonymsMOR261-2, GA_x6K02T2P3E9-4602571-4601639
MMRRC Submission 039412-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1347 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42949067-42956764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 42955705 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 69 (D69A)
Ref Sequence ENSEMBL: ENSMUSP00000144691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095955] [ENSMUST00000204092]
Predicted Effect probably damaging
Transcript: ENSMUST00000095955
AA Change: D69A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093649
Gene: ENSMUSG00000073110
AA Change: D69A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1e-60 PFAM
Pfam:7tm_1 40 289 6.1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204092
AA Change: D69A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144691
Gene: ENSMUSG00000073110
AA Change: D69A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.6e-60 PFAM
Pfam:7tm_1 40 289 3.5e-26 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.4%
  • 10x: 88.6%
  • 20x: 71.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Arpc1a G T 5: 145,097,272 W150L probably damaging Het
Filip1l A G 16: 57,570,987 D646G probably damaging Het
Foxa1 A T 12: 57,542,284 H383Q probably damaging Het
Fpr-rs6 T C 17: 20,182,749 T117A probably benign Het
Fry A T 5: 150,495,818 E905V probably damaging Het
Glyr1 T C 16: 5,021,339 D338G probably damaging Het
Gpd2 A T 2: 57,357,671 K542M probably damaging Het
Itpr3 T C 17: 27,111,561 F1679L probably benign Het
Kif23 A G 9: 61,927,156 M427T probably damaging Het
Kpna1 T A 16: 36,009,326 I83N probably benign Het
Man2a1 T C 17: 64,712,450 F770L probably damaging Het
Mrpl44 T A 1: 79,777,952 F92I probably damaging Het
Olfr1458 T C 19: 13,102,690 I199V probably benign Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rims3 G A 4: 120,883,125 G90S probably damaging Het
Rock2 G A 12: 16,977,624 C1314Y possibly damaging Het
Serpinb6e C T 13: 33,841,197 C37Y possibly damaging Het
Spata31d1c C T 13: 65,035,388 T248I probably benign Het
Tbx15 C A 3: 99,352,111 Q433K possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zim1 C A 7: 6,677,431 C411F probably damaging Het
Other mutations in Olfr444
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Olfr444 APN 6 42956436 utr 3 prime probably benign
IGL02135:Olfr444 APN 6 42955651 missense probably damaging 0.99
IGL02323:Olfr444 APN 6 42955983 missense probably benign 0.02
IGL02398:Olfr444 APN 6 42956112 missense probably benign 0.02
IGL02622:Olfr444 APN 6 42955729 missense probably damaging 0.99
R0077:Olfr444 UTSW 6 42955773 missense probably benign 0.13
R0416:Olfr444 UTSW 6 42955570 missense probably benign
R0959:Olfr444 UTSW 6 42955752 missense probably benign
R1181:Olfr444 UTSW 6 42955558 missense probably benign 0.23
R1347:Olfr444 UTSW 6 42955705 missense probably damaging 1.00
R1604:Olfr444 UTSW 6 42955716 missense possibly damaging 0.73
R3021:Olfr444 UTSW 6 42956184 missense possibly damaging 0.91
R4226:Olfr444 UTSW 6 42955755 missense probably benign
R4227:Olfr444 UTSW 6 42955714 missense possibly damaging 0.95
R4776:Olfr444 UTSW 6 42955521 missense probably benign 0.00
R5941:Olfr444 UTSW 6 42955716 missense possibly damaging 0.86
R7539:Olfr444 UTSW 6 42956103 missense possibly damaging 0.95
R7763:Olfr444 UTSW 6 42955789 missense probably benign 0.00
X0063:Olfr444 UTSW 6 42956019 missense possibly damaging 0.64
Z1176:Olfr444 UTSW 6 42955690 missense probably damaging 1.00
Z1176:Olfr444 UTSW 6 42956298 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GGATTCCAAGCAGACCTGAGTGTG -3'
(R):5'- CCAGCTTGAGGACAGACAGGATTTC -3'

Sequencing Primer
(F):5'- CAGACCTGAGTGTGGAGTG -3'
(R):5'- GCCAGGATGGTACACACTTTC -3'
Posted On2014-02-11