Incidental Mutation 'R1347:Rock2'
ID156539
Institutional Source Beutler Lab
Gene Symbol Rock2
Ensembl Gene ENSMUSG00000020580
Gene NameRho-associated coiled-coil containing protein kinase 2
SynonymsB230113H15Rik, ROKalpha, Rho-kinase, Rock-II, Rock2m
MMRRC Submission 039412-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.823) question?
Stock #R1347 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location16894895-16987823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 16977624 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1314 (C1314Y)
Ref Sequence ENSEMBL: ENSMUSP00000152813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020904] [ENSMUST00000220688]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020904
AA Change: C1257Y

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580
AA Change: C1257Y

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
S_TKc 92 354 9.2e-96 SMART
S_TK_X 357 417 3.24e-13 SMART
PDB:3O0Z|D 552 717 4e-46 PDB
low complexity region 723 743 N/A INTRINSIC
low complexity region 882 909 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
Pfam:Rho_Binding 978 1046 4.7e-28 PFAM
coiled coil region 1054 1126 N/A INTRINSIC
PH 1151 1351 2.88e-5 SMART
C1 1261 1315 2.21e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000220688
AA Change: C1314Y

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect unknown
Transcript: ENSMUST00000221463
AA Change: C130Y
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.4%
  • 10x: 88.6%
  • 20x: 71.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. This protein, which is an isozyme of ROCK1 is a target for the small GTPase Rho. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this genes tend to die before birth; those that survive are small. Hemorrhaging occurs in the placenta, at the tips of hind limb buds and occasionally the tail. Subsequent development is normal and the size deficit is made up. They are fertile as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Arpc1a G T 5: 145,097,272 W150L probably damaging Het
Filip1l A G 16: 57,570,987 D646G probably damaging Het
Foxa1 A T 12: 57,542,284 H383Q probably damaging Het
Fpr-rs6 T C 17: 20,182,749 T117A probably benign Het
Fry A T 5: 150,495,818 E905V probably damaging Het
Glyr1 T C 16: 5,021,339 D338G probably damaging Het
Gpd2 A T 2: 57,357,671 K542M probably damaging Het
Itpr3 T C 17: 27,111,561 F1679L probably benign Het
Kif23 A G 9: 61,927,156 M427T probably damaging Het
Kpna1 T A 16: 36,009,326 I83N probably benign Het
Man2a1 T C 17: 64,712,450 F770L probably damaging Het
Mrpl44 T A 1: 79,777,952 F92I probably damaging Het
Olfr1458 T C 19: 13,102,690 I199V probably benign Het
Olfr444 A C 6: 42,955,705 D69A probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rims3 G A 4: 120,883,125 G90S probably damaging Het
Serpinb6e C T 13: 33,841,197 C37Y possibly damaging Het
Spata31d1c C T 13: 65,035,388 T248I probably benign Het
Tbx15 C A 3: 99,352,111 Q433K possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zim1 C A 7: 6,677,431 C411F probably damaging Het
Other mutations in Rock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Rock2 APN 12 16978055 missense probably benign 0.11
IGL01565:Rock2 APN 12 16953317 missense possibly damaging 0.62
IGL01637:Rock2 APN 12 16965171 missense probably benign
IGL02164:Rock2 APN 12 16965529 missense probably damaging 1.00
IGL02249:Rock2 APN 12 16971041 unclassified probably benign
IGL02490:Rock2 APN 12 16948563 missense probably damaging 1.00
IGL02815:Rock2 APN 12 16966701 splice site probably benign
IGL02979:Rock2 APN 12 16977940 missense probably benign 0.00
IGL03095:Rock2 APN 12 16953340 missense probably benign 0.00
IGL03198:Rock2 APN 12 16975507 missense probably benign 0.27
R0087:Rock2 UTSW 12 16928966 missense probably benign 0.20
R0189:Rock2 UTSW 12 16959516 splice site probably benign
R0282:Rock2 UTSW 12 16977886 splice site probably benign
R0497:Rock2 UTSW 12 16954953 missense probably benign
R1210:Rock2 UTSW 12 16965469 missense probably damaging 0.96
R1347:Rock2 UTSW 12 16977624 missense possibly damaging 0.70
R1616:Rock2 UTSW 12 16972985 missense probably benign 0.03
R1672:Rock2 UTSW 12 16965652 missense probably benign 0.03
R1815:Rock2 UTSW 12 16972726 missense probably benign 0.01
R1840:Rock2 UTSW 12 16928989 missense probably benign
R2349:Rock2 UTSW 12 16977615 missense probably benign 0.07
R3149:Rock2 UTSW 12 16965091 missense probably damaging 1.00
R3979:Rock2 UTSW 12 16972736 missense probably damaging 1.00
R4030:Rock2 UTSW 12 16975479 missense probably damaging 1.00
R4470:Rock2 UTSW 12 16971275 nonsense probably null
R4492:Rock2 UTSW 12 16977683 missense probably damaging 1.00
R4519:Rock2 UTSW 12 16977737 missense probably damaging 1.00
R4776:Rock2 UTSW 12 16977740 missense probably damaging 1.00
R4794:Rock2 UTSW 12 16940407 missense probably damaging 1.00
R4908:Rock2 UTSW 12 16959491 missense probably benign 0.00
R5363:Rock2 UTSW 12 16965654 critical splice donor site probably null
R5574:Rock2 UTSW 12 16961641 missense possibly damaging 0.55
R5595:Rock2 UTSW 12 16942809 missense probably damaging 1.00
R6158:Rock2 UTSW 12 16954918 missense probably benign
R6728:Rock2 UTSW 12 16961736 missense probably benign 0.00
R6828:Rock2 UTSW 12 16942959 splice site probably null
R7019:Rock2 UTSW 12 16977740 missense probably damaging 1.00
R7181:Rock2 UTSW 12 16973143 missense probably benign 0.00
R7236:Rock2 UTSW 12 16929002 missense probably damaging 1.00
R7362:Rock2 UTSW 12 16958421 missense probably damaging 1.00
R7593:Rock2 UTSW 12 16958240 missense probably benign 0.00
R7743:Rock2 UTSW 12 16976047 missense probably damaging 1.00
R7782:Rock2 UTSW 12 16971110 missense probably benign 0.17
R8012:Rock2 UTSW 12 16942742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAAAGTGACTGTCTCGTGTCGTTTA -3'
(R):5'- GCACAGCAAGACGTTCCTACTTACCT -3'

Sequencing Primer
(F):5'- tttgatgccctcttctgacc -3'
(R):5'- TTTGCAGGGCGCTATAATCTC -3'
Posted On2014-02-11