Incidental Mutation 'R1319:Epha10'
ID 157627
Institutional Source Beutler Lab
Gene Symbol Epha10
Ensembl Gene ENSMUSG00000028876
Gene Name Eph receptor A10
Synonyms
MMRRC Submission 039385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1319 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 124880899-124917800 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 124881914 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 14 (V14I)
Ref Sequence ENSEMBL: ENSMUSP00000050810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059343]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000059343
AA Change: V14I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050810
Gene: ENSMUSG00000028876
AA Change: V14I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EPH_lbd 35 211 2.5e-109 SMART
low complexity region 219 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149146
SMART Domains Protein: ENSMUSP00000118801
Gene: ENSMUSG00000028876

DomainStartEndE-ValueType
Pfam:Ephrin_lbd 1 66 2.2e-25 PFAM
low complexity region 74 87 N/A INTRINSIC
FN3 193 290 6.54e-6 SMART
FN3 306 392 1.66e-7 SMART
Pfam:EphA2_TM 421 496 2.4e-15 PFAM
TyrKc 499 754 5.17e-90 SMART
SAM 784 851 1.2e-15 SMART
low complexity region 852 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors, the largest subfamily of receptor tyrosine kinases (RTKs), and their ephrin ligands are important mediators of cell-cell communication regulating cell attachment, shape, and mobility in neuronal and epithelial cells (Aasheim et al., 2005 [PubMed 15777695]). See MIM 179610 for additional background on Eph receptors and ephrins.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A T 2: 173,527,923 S77C probably damaging Het
Adam28 T C 14: 68,609,129 E745G probably benign Het
Adamts12 G T 15: 11,286,791 K827N probably benign Het
Ang2 T C 14: 51,195,707 T73A probably benign Het
Bbs10 T C 10: 111,298,874 L51P probably damaging Het
Bean1 T C 8: 104,217,224 I137T probably benign Het
Cttnbp2 T C 6: 18,434,630 T410A probably benign Het
Cyp4a10 A C 4: 115,521,145 I143L probably damaging Het
Dlg2 A T 7: 92,438,023 Q788L probably damaging Het
Eprs G A 1: 185,384,962 D401N probably damaging Het
Fam169a T C 13: 97,097,562 V114A probably damaging Het
Fbn2 G A 18: 58,200,610 P178S possibly damaging Het
Fcrls A C 3: 87,262,177 probably null Het
Grm1 G T 10: 10,689,398 H1055Q probably benign Het
Mcm6 T C 1: 128,349,052 N267S probably benign Het
Olfr262 T C 19: 12,241,502 D53G probably damaging Het
Phc3 T C 3: 30,929,869 I699V probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pyroxd1 T C 6: 142,359,148 V367A probably benign Het
R3hdm1 G A 1: 128,231,405 R939H probably benign Het
Rag1 A T 2: 101,643,192 I535N probably damaging Het
Rhot1 T C 11: 80,246,021 C310R probably damaging Het
Tnrc6a G A 7: 123,184,251 V1481M probably benign Het
Vmn1r234 A T 17: 21,228,910 M29L probably benign Het
Vmn2r68 A G 7: 85,232,492 I460T probably damaging Het
Zfhx3 T A 8: 108,933,833 Y1240N probably damaging Het
Other mutations in Epha10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01969:Epha10 APN 4 124885877 missense probably damaging 1.00
R1544:Epha10 UTSW 4 124885596 missense probably damaging 1.00
R4504:Epha10 UTSW 4 124915687 unclassified probably benign
R4505:Epha10 UTSW 4 124915687 unclassified probably benign
R4507:Epha10 UTSW 4 124915687 unclassified probably benign
R4572:Epha10 UTSW 4 124902568 missense unknown
R4605:Epha10 UTSW 4 124885757 missense probably damaging 1.00
R4818:Epha10 UTSW 4 124886214 critical splice donor site probably null
R5037:Epha10 UTSW 4 124915385 unclassified probably benign
R5281:Epha10 UTSW 4 124913988 unclassified probably benign
R5319:Epha10 UTSW 4 124914000 unclassified probably benign
R5322:Epha10 UTSW 4 124885748 missense probably damaging 1.00
R5400:Epha10 UTSW 4 124914121 unclassified probably benign
R5681:Epha10 UTSW 4 124902566 missense unknown
R5694:Epha10 UTSW 4 124902653 missense unknown
R6813:Epha10 UTSW 4 124902693 missense
R7471:Epha10 UTSW 4 124902572 missense
R7699:Epha10 UTSW 4 124902647 missense
R7732:Epha10 UTSW 4 124915299 missense
R7735:Epha10 UTSW 4 124913679 missense
R7793:Epha10 UTSW 4 124914453 missense probably benign 0.00
R7899:Epha10 UTSW 4 124914835 missense
R8057:Epha10 UTSW 4 124902683 missense
R8142:Epha10 UTSW 4 124885846 missense probably damaging 0.99
R8558:Epha10 UTSW 4 124894984 missense
R9136:Epha10 UTSW 4 124902634 missense
X0026:Epha10 UTSW 4 124885547 missense probably damaging 1.00
Z1176:Epha10 UTSW 4 124883942 missense probably damaging 1.00
Z1176:Epha10 UTSW 4 124885775 missense probably damaging 1.00
Z1177:Epha10 UTSW 4 124881960 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTAAGGGTCTCTAGTCCACCGACG -3'
(R):5'- GGTTTCAAGCCCCAACACAGAGTAG -3'

Sequencing Primer
(F):5'- ATGCCTAGCGATTGGTCC -3'
(R):5'- GAGTAGTCTCTCCAACGAATCCTTAC -3'
Posted On 2014-02-18