Mutagenetix > Incidental Mutations

Incidental Mutation 'R1532:Entpd6'

166634

Institutional Source

Beutler Lab

Gene Symbol

Entpd6

Ensembl Gene

ENSMUSG00000033068

Gene Name

ectonucleoside triphosphate diphosphohydrolase 6

Synonyms

NTPDase-6, 2700026H11Rik, Cd39l2

MMRRC Submission

039571-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1532 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

150749042-150771675 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 150758750 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 126 (Q126R)

Ref Sequence

ENSEMBL: ENSMUSP00000092038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094467]

Predicted Effect

probably benign
Transcript: ENSMUST00000094467
AA Change: Q126R

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000092038
Gene: ENSMUSG00000033068
AA Change: Q126R

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
low complexity region	37	51	N/A	INTRINSIC
Pfam:GDA1_CD39	65	453	7.2e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146517

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147223

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ENTPD6 is similar to E-type nucleotidases (NTPases). NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD6 contains 4 apyrase-conserved regions which are characteristic of NTPases. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl1	C	A	4: 86,248,065	H394N	probably benign	Het
Ahrr	A	G	13: 74,213,707	S558P	probably benign	Het
Ankrd26	T	C	6: 118,522,958	N1184S	probably damaging	Het
Anpep	A	T	7: 79,826,948	C14*	probably null	Het
Arhgap18	A	G	10: 26,860,722	D187G	possibly damaging	Het
Arhgef5	A	G	6: 43,273,403	T363A	probably benign	Het
Atxn1	A	T	13: 45,566,910	L503Q	possibly damaging	Het
Babam1	A	G	8: 71,399,633	D155G	possibly damaging	Het
Bbs9	A	G	9: 22,887,649	T858A	probably benign	Het
Cacna1g	C	A	11: 94,443,331	G828V	probably damaging	Het
Ccar2	T	C	14: 70,142,956	T392A	probably benign	Het
Cd163	T	C	6: 124,312,730	V469A	possibly damaging	Het
Cdh23	G	T	10: 60,314,331	N2576K	probably damaging	Het
Coro2b	A	G	9: 62,489,423	Y18H	probably damaging	Het
Crispld2	G	T	8: 120,023,572	K238N	probably benign	Het
Ctnnd2	T	C	15: 30,921,868	I880T	probably damaging	Het
Cubn	C	A	2: 13,287,661	C3237F	probably damaging	Het
Ddx31	A	G	2: 28,881,159	M519V	probably benign	Het
Dhx32	A	T	7: 133,749,024	C106S	possibly damaging	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dnaaf1	T	C	8: 119,577,423	F67L	probably benign	Het
Duox1	T	G	2: 122,344,723	L1334R	probably damaging	Het
Dync1li2	A	T	8: 104,426,035	I322N	probably damaging	Het
Eml6	T	C	11: 29,792,256		probably null	Het
Entpd7	C	G	19: 43,691,077	P23R	possibly damaging	Het
Epha3	T	C	16: 63,546,178	I970V	probably benign	Het
Fras1	A	T	5: 96,713,996	H2163L	probably damaging	Het
Gse1	C	G	8: 120,568,210		probably benign	Het
Heatr5a	A	G	12: 51,952,518	V300A	probably damaging	Het
Hsd3b1	T	A	3: 98,852,898	D259V	probably damaging	Het
Hspbap1	T	C	16: 35,825,303	S453P	probably damaging	Het
Ifnl3	A	G	7: 28,524,227	T163A	probably benign	Het
Igbp1b	T	A	6: 138,658,444	M1L	possibly damaging	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Lpxn	T	C	19: 12,804,092		probably null	Het
Mast1	G	A	8: 84,928,609	Q249*	probably null	Het
Mink1	A	G	11: 70,602,007	D153G	probably null	Het
Mllt10	G	A	2: 18,092,835		probably null	Het
Mpl	C	T	4: 118,448,568	G420E	possibly damaging	Het
Ms4a1	T	A	19: 11,253,193	T215S	probably benign	Het
Ncapd3	C	T	9: 27,083,360	Q1179*	probably null	Het
Nr3c2	A	G	8: 76,909,104	H278R	probably damaging	Het
Olfr1417	T	C	19: 11,828,619	I136V	probably benign	Het
Olfr1454	A	G	19: 13,064,275	Y288C	probably damaging	Het
Olfr670	T	C	7: 104,960,265	I156V	probably benign	Het
Os9	C	T	10: 127,098,902	V353M	probably damaging	Het
Osbpl5	A	T	7: 143,695,080	M589K	probably benign	Het
Phf20	G	T	2: 156,303,049	G859V	possibly damaging	Het
Pkhd1	G	A	1: 20,117,401	T3561I	probably benign	Het
Prss46	G	A	9: 110,850,168	V146I	probably benign	Het
Ptprk	G	A	10: 28,585,630	V1139M	probably damaging	Het
Ranbp10	A	G	8: 105,774,331	L396P	probably benign	Het
Rb1cc1	A	G	1: 6,249,734	T1126A	probably benign	Het
Rbl2	G	A	8: 91,106,417	A659T	probably benign	Het
Rdm1	T	C	11: 101,633,817	L192P	probably damaging	Het
Reln	A	C	5: 22,034,744	W842G	probably damaging	Het
Scn5a	C	T	9: 119,533,847	R569H	probably damaging	Het
Sele	A	G	1: 164,053,851	K509R	probably benign	Het
Slc15a1	A	T	14: 121,475,984	I377N	possibly damaging	Het
Slc17a3	G	A	13: 23,856,500	G269D	probably damaging	Het
Slc35a5	T	C	16: 45,151,557	T115A	probably benign	Het
Slc5a12	T	G	2: 110,610,138	N157K	possibly damaging	Het
Sphkap	A	G	1: 83,257,203	V1634A	probably damaging	Het
Spta1	T	C	1: 174,247,353	S2382P	probably damaging	Het
Synj2	C	A	17: 6,033,919	S1100R	probably benign	Het
Tcf23	A	G	5: 30,973,557	T180A	probably benign	Het
Tnxb	T	C	17: 34,710,830	V2846A	probably damaging	Het
Tpr	T	A	1: 150,418,000	I915K	probably damaging	Het
Uba1y	C	T	Y: 828,862	H557Y	probably benign	Het
Unc45b	T	A	11: 82,936,874	D730E	probably benign	Het
Unc5b	A	T	10: 60,769,232	L734Q	probably damaging	Het
Vmn1r167	G	T	7: 23,504,779	H271N	probably benign	Het
Vmn2r76	A	G	7: 86,230,246	V282A	probably benign	Het
Xirp2	A	G	2: 67,513,939	K2175E	probably benign	Het

Other mutations in Entpd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01890:Entpd6	APN	2	150770692	missense	possibly damaging	0.76
IGL01980:Entpd6	APN	2	150762366	splice site	probably null
IGL03208:Entpd6	APN	2	150768918	missense	probably damaging	0.96
R0057:Entpd6	UTSW	2	150758828	missense	probably null	0.90
R0403:Entpd6	UTSW	2	150760170	missense	possibly damaging	0.95
R1035:Entpd6	UTSW	2	150764192	splice site	probably benign
R1485:Entpd6	UTSW	2	150768923	critical splice donor site	probably null
R1921:Entpd6	UTSW	2	150758812	missense	probably damaging	1.00
R4772:Entpd6	UTSW	2	150767094	missense	probably damaging	1.00
R5026:Entpd6	UTSW	2	150763644	missense	probably damaging	1.00
R5356:Entpd6	UTSW	2	150770383	missense	probably damaging	1.00
R6944:Entpd6	UTSW	2	150763599	missense	probably damaging	1.00
R7857:Entpd6	UTSW	2	150765553	critical splice donor site	probably null
R7949:Entpd6	UTSW	2	150770277	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AAGGGCTGTCCTCCATGTTCTGAC -3'
(R):5'- GTCCTGCCTGCTTGACACTAACTG -3'

Sequencing Primer
(F):5'- gccatagcagaaacgagagac -3'
(R):5'- tacaccagcacgcccag -3'

Posted On

2014-04-13