Incidental Mutation 'R1510:Stc2'
ID167866
Institutional Source Beutler Lab
Gene Symbol Stc2
Ensembl Gene ENSMUSG00000020303
Gene Namestanniocalcin 2
SynonymsStc2l, mustc2
MMRRC Submission 039557-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1510 (G1)
Quality Score221
Status Validated
Chromosome11
Chromosomal Location31357307-31370074 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 31365418 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 140 (Y140*)
Ref Sequence ENSEMBL: ENSMUSP00000020546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020546]
Predicted Effect probably null
Transcript: ENSMUST00000020546
AA Change: Y140*
SMART Domains Protein: ENSMUSP00000020546
Gene: ENSMUSG00000020303
AA Change: Y140*

DomainStartEndE-ValueType
Pfam:Stanniocalcin 12 215 1.4e-94 PFAM
low complexity region 271 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152094
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are 10-15% larger and grow at a faster rate than wild-type controls from 4 weeks onward. The increased body weight results from an increase in the weight of most major organs, with the exception of testis. Mean alkaline phosphatase levels are 144% of wild-type levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,304,212 Q102L probably benign Het
1700001L19Rik T A 13: 68,597,477 M1K probably null Het
Abcd2 A G 15: 91,188,978 L326S probably damaging Het
Adam18 T A 8: 24,625,831 T616S probably benign Het
Adam22 T C 5: 8,152,408 K215E probably benign Het
Ahi1 T G 10: 20,959,800 S11A probably benign Het
Asb18 T C 1: 89,996,254 M96V possibly damaging Het
Baz2b T C 2: 59,922,209 D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,636 E176G probably benign Het
Cd151 T A 7: 141,470,367 S172T probably benign Het
Cdh2 G T 18: 16,648,594 L90I probably benign Het
Cdkl3 T C 11: 52,033,514 V55A possibly damaging Het
Chst8 T A 7: 34,675,268 H382L probably benign Het
Cyb5r4 T C 9: 87,066,643 probably benign Het
Cyp2j13 T C 4: 96,061,972 D264G possibly damaging Het
Daam1 A G 12: 71,977,726 M814V probably damaging Het
Ddx19b A G 8: 111,015,653 I150T probably damaging Het
Dync1li1 T G 9: 114,689,210 S50A possibly damaging Het
Fat3 A T 9: 15,960,055 L3680Q probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Gm21286 T G 4: 60,838,932 noncoding transcript Het
Il6 T C 5: 30,018,062 Y126H probably damaging Het
Inhba G T 13: 16,027,022 V390L probably damaging Het
Ino80 C T 2: 119,450,049 R278H probably damaging Het
Jade3 T G X: 20,517,818 N799K probably benign Het
Kcnn1 G A 8: 70,864,070 probably benign Het
Klhl6 T C 16: 19,947,098 T585A probably damaging Het
Kmt2d T A 15: 98,856,377 probably benign Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lce1b T G 3: 92,655,976 R83S unknown Het
Lck T C 4: 129,555,668 S290G possibly damaging Het
Ltbp3 T C 19: 5,748,887 S544P probably benign Het
Lypd6b T A 2: 49,934,819 S4R probably damaging Het
Macf1 T C 4: 123,434,762 D4724G probably null Het
Mcoln2 A G 3: 146,176,610 T255A probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Mki67 C A 7: 135,696,171 R2378L probably benign Het
Mxd1 A G 6: 86,653,155 V27A possibly damaging Het
Myo5a T C 9: 75,171,551 Y864H probably benign Het
Ndel1 A T 11: 68,822,656 N318K possibly damaging Het
Oasl1 A G 5: 114,928,108 Q95R probably benign Het
Olfr1052 T C 2: 86,298,371 L185P probably damaging Het
Olfr1415 A T 1: 92,491,617 I46N probably damaging Het
Olfr198 A T 16: 59,202,183 M81K probably damaging Het
Olfr480 T C 7: 108,066,528 Y60C probably damaging Het
Parp10 T A 15: 76,241,417 Q487L probably damaging Het
Pcdh10 C T 3: 45,379,403 R51C probably damaging Het
Pdpr A T 8: 111,124,475 probably benign Het
Pfpl A T 19: 12,429,696 D437V probably benign Het
Pik3c2a G A 7: 116,388,045 T547I probably benign Het
Pkdrej A C 15: 85,816,762 S1658A possibly damaging Het
Pkn3 T C 2: 30,079,764 probably null Het
Plekhh2 A G 17: 84,559,576 probably null Het
Plxdc1 A T 11: 97,932,324 C357S probably damaging Het
Pnp A G 14: 50,950,585 T132A possibly damaging Het
Rcan2 A G 17: 43,836,424 D51G probably damaging Het
Rcn1 T C 2: 105,389,089 N253S probably damaging Het
Rreb1 T A 13: 37,931,884 I1073N probably benign Het
Scaf4 G T 16: 90,245,394 D686E unknown Het
Sfxn5 A C 6: 85,236,925 M221R probably damaging Het
Slc38a1 A G 15: 96,609,860 F104L probably damaging Het
Slc8a1 A T 17: 81,648,118 V497D probably damaging Het
Spryd3 C A 15: 102,118,961 G290C probably damaging Het
Stfa2 A T 16: 36,408,311 I8K possibly damaging Het
Sult3a2 A T 10: 33,782,030 M29K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Triobp G A 15: 79,003,767 R1908Q probably damaging Het
Trpm2 T A 10: 77,966,994 R7* probably null Het
Ttn T C 2: 76,952,157 I912V probably benign Het
Tusc2 T A 9: 107,564,881 V93E probably damaging Het
Uhrf2 T A 19: 30,039,061 probably benign Het
Umodl1 G A 17: 30,959,229 V60M probably damaging Het
Ush2a A T 1: 188,648,304 D2270V probably damaging Het
Vmn2r80 A G 10: 79,169,719 T397A possibly damaging Het
Wbp2 A G 11: 116,086,882 V15A probably benign Het
Zfp182 T A X: 21,030,207 R617W probably damaging Het
Zfp82 C A 7: 30,056,622 R345L probably damaging Het
Zfp85 T C 13: 67,754,965 probably benign Het
Other mutations in Stc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Stc2 APN 11 31367875 splice site probably benign
IGL03330:Stc2 APN 11 31369804 missense probably benign 0.01
R0016:Stc2 UTSW 11 31360177 missense probably benign 0.00
R0016:Stc2 UTSW 11 31360177 missense probably benign 0.00
R0025:Stc2 UTSW 11 31365559 splice site probably null
R4581:Stc2 UTSW 11 31365326 splice site probably null
R6106:Stc2 UTSW 11 31360392 missense probably benign
R6252:Stc2 UTSW 11 31360346 missense probably damaging 0.98
R6675:Stc2 UTSW 11 31360307 missense probably benign
R6797:Stc2 UTSW 11 31365351 nonsense probably null
R7192:Stc2 UTSW 11 31369872 start gained probably benign
R7545:Stc2 UTSW 11 31367799 missense probably damaging 1.00
R7570:Stc2 UTSW 11 31367798 missense probably damaging 1.00
R7846:Stc2 UTSW 11 31365413 missense probably benign 0.13
R8057:Stc2 UTSW 11 31367806 nonsense probably null
R8273:Stc2 UTSW 11 31369777 missense possibly damaging 0.80
Z1176:Stc2 UTSW 11 31360415 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCATCCTTGAACATACTTCCAGCCC -3'
(R):5'- ACATCCACTCTAGCCTGATGCACG -3'

Sequencing Primer
(F):5'- TACTTCCAGCCCTCAGGAC -3'
(R):5'- GACTCTGAGATCAAAGACTCCTGTG -3'
Posted On2014-04-13