Incidental Mutation 'R1510:Zfp85'
ID167877
Institutional Source Beutler Lab
Gene Symbol Zfp85
Ensembl Gene ENSMUSG00000058331
Gene Namezinc finger protein 85
SynonymsZfp71, Zfp85-rs1, KRAB19
MMRRC Submission 039557-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1510 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67747800-67755228 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 67754965 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091520] [ENSMUST00000144183]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000049518
Predicted Effect probably benign
Transcript: ENSMUST00000091520
SMART Domains Protein: ENSMUSP00000089105
Gene: ENSMUSG00000058331

DomainStartEndE-ValueType
KRAB 5 65 5.78e-29 SMART
ZnF_C2H2 81 103 1.95e-3 SMART
ZnF_C2H2 109 131 1.22e-4 SMART
ZnF_C2H2 137 159 6.32e-3 SMART
ZnF_C2H2 165 187 2.95e-3 SMART
ZnF_C2H2 193 215 3.89e-3 SMART
ZnF_C2H2 221 243 3.89e-3 SMART
ZnF_C2H2 249 271 1.1e-2 SMART
ZnF_C2H2 277 299 2.91e-2 SMART
ZnF_C2H2 305 327 2.49e-1 SMART
ZnF_C2H2 333 355 2.09e-3 SMART
ZnF_C2H2 361 383 4.17e-3 SMART
ZnF_C2H2 389 411 2.95e-3 SMART
ZnF_C2H2 417 439 1.3e-4 SMART
ZnF_C2H2 445 467 1.04e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143812
Predicted Effect probably benign
Transcript: ENSMUST00000144183
SMART Domains Protein: ENSMUSP00000121202
Gene: ENSMUSG00000058331

DomainStartEndE-ValueType
KRAB 45 105 5.78e-29 SMART
ZnF_C2H2 121 143 1.95e-3 SMART
ZnF_C2H2 149 171 1.22e-4 SMART
ZnF_C2H2 177 199 6.32e-3 SMART
ZnF_C2H2 205 227 2.95e-3 SMART
ZnF_C2H2 233 255 3.89e-3 SMART
ZnF_C2H2 261 283 3.89e-3 SMART
ZnF_C2H2 289 311 1.1e-2 SMART
ZnF_C2H2 317 339 2.91e-2 SMART
ZnF_C2H2 345 367 2.49e-1 SMART
ZnF_C2H2 373 395 2.09e-3 SMART
ZnF_C2H2 401 423 4.17e-3 SMART
ZnF_C2H2 429 451 2.95e-3 SMART
ZnF_C2H2 457 479 1.3e-4 SMART
ZnF_C2H2 485 507 1.04e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181158
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,304,212 Q102L probably benign Het
1700001L19Rik T A 13: 68,597,477 M1K probably null Het
Abcd2 A G 15: 91,188,978 L326S probably damaging Het
Adam18 T A 8: 24,625,831 T616S probably benign Het
Adam22 T C 5: 8,152,408 K215E probably benign Het
Ahi1 T G 10: 20,959,800 S11A probably benign Het
Asb18 T C 1: 89,996,254 M96V possibly damaging Het
Baz2b T C 2: 59,922,209 D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,636 E176G probably benign Het
Cd151 T A 7: 141,470,367 S172T probably benign Het
Cdh2 G T 18: 16,648,594 L90I probably benign Het
Cdkl3 T C 11: 52,033,514 V55A possibly damaging Het
Chst8 T A 7: 34,675,268 H382L probably benign Het
Cyb5r4 T C 9: 87,066,643 probably benign Het
Cyp2j13 T C 4: 96,061,972 D264G possibly damaging Het
Daam1 A G 12: 71,977,726 M814V probably damaging Het
Ddx19b A G 8: 111,015,653 I150T probably damaging Het
Dync1li1 T G 9: 114,689,210 S50A possibly damaging Het
Fat3 A T 9: 15,960,055 L3680Q probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Gm21286 T G 4: 60,838,932 noncoding transcript Het
Il6 T C 5: 30,018,062 Y126H probably damaging Het
Inhba G T 13: 16,027,022 V390L probably damaging Het
Ino80 C T 2: 119,450,049 R278H probably damaging Het
Jade3 T G X: 20,517,818 N799K probably benign Het
Kcnn1 G A 8: 70,864,070 probably benign Het
Klhl6 T C 16: 19,947,098 T585A probably damaging Het
Kmt2d T A 15: 98,856,377 probably benign Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lce1b T G 3: 92,655,976 R83S unknown Het
Lck T C 4: 129,555,668 S290G possibly damaging Het
Ltbp3 T C 19: 5,748,887 S544P probably benign Het
Lypd6b T A 2: 49,934,819 S4R probably damaging Het
Macf1 T C 4: 123,434,762 D4724G probably null Het
Mcoln2 A G 3: 146,176,610 T255A probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Mki67 C A 7: 135,696,171 R2378L probably benign Het
Mxd1 A G 6: 86,653,155 V27A possibly damaging Het
Myo5a T C 9: 75,171,551 Y864H probably benign Het
Ndel1 A T 11: 68,822,656 N318K possibly damaging Het
Oasl1 A G 5: 114,928,108 Q95R probably benign Het
Olfr1052 T C 2: 86,298,371 L185P probably damaging Het
Olfr1415 A T 1: 92,491,617 I46N probably damaging Het
Olfr198 A T 16: 59,202,183 M81K probably damaging Het
Olfr480 T C 7: 108,066,528 Y60C probably damaging Het
Parp10 T A 15: 76,241,417 Q487L probably damaging Het
Pcdh10 C T 3: 45,379,403 R51C probably damaging Het
Pdpr A T 8: 111,124,475 probably benign Het
Pfpl A T 19: 12,429,696 D437V probably benign Het
Pik3c2a G A 7: 116,388,045 T547I probably benign Het
Pkdrej A C 15: 85,816,762 S1658A possibly damaging Het
Pkn3 T C 2: 30,079,764 probably null Het
Plekhh2 A G 17: 84,559,576 probably null Het
Plxdc1 A T 11: 97,932,324 C357S probably damaging Het
Pnp A G 14: 50,950,585 T132A possibly damaging Het
Rcan2 A G 17: 43,836,424 D51G probably damaging Het
Rcn1 T C 2: 105,389,089 N253S probably damaging Het
Rreb1 T A 13: 37,931,884 I1073N probably benign Het
Scaf4 G T 16: 90,245,394 D686E unknown Het
Sfxn5 A C 6: 85,236,925 M221R probably damaging Het
Slc38a1 A G 15: 96,609,860 F104L probably damaging Het
Slc8a1 A T 17: 81,648,118 V497D probably damaging Het
Spryd3 C A 15: 102,118,961 G290C probably damaging Het
Stc2 A T 11: 31,365,418 Y140* probably null Het
Stfa2 A T 16: 36,408,311 I8K possibly damaging Het
Sult3a2 A T 10: 33,782,030 M29K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Triobp G A 15: 79,003,767 R1908Q probably damaging Het
Trpm2 T A 10: 77,966,994 R7* probably null Het
Ttn T C 2: 76,952,157 I912V probably benign Het
Tusc2 T A 9: 107,564,881 V93E probably damaging Het
Uhrf2 T A 19: 30,039,061 probably benign Het
Umodl1 G A 17: 30,959,229 V60M probably damaging Het
Ush2a A T 1: 188,648,304 D2270V probably damaging Het
Vmn2r80 A G 10: 79,169,719 T397A possibly damaging Het
Wbp2 A G 11: 116,086,882 V15A probably benign Het
Zfp182 T A X: 21,030,207 R617W probably damaging Het
Zfp82 C A 7: 30,056,622 R345L probably damaging Het
Other mutations in Zfp85
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0383:Zfp85 UTSW 13 67748672 missense probably benign 0.05
R1187:Zfp85 UTSW 13 67749716 missense probably damaging 0.99
R1775:Zfp85 UTSW 13 67749704 missense probably damaging 0.99
R1803:Zfp85 UTSW 13 67751628 missense probably benign 0.15
R2108:Zfp85 UTSW 13 67748884 missense probably benign 0.08
R2412:Zfp85 UTSW 13 67749646 missense probably damaging 0.99
R3147:Zfp85 UTSW 13 67752493 missense probably damaging 0.96
R4811:Zfp85 UTSW 13 67749626 missense probably damaging 0.97
R5308:Zfp85 UTSW 13 67748855 missense probably damaging 1.00
R5334:Zfp85 UTSW 13 67751684 missense probably damaging 0.99
R5373:Zfp85 UTSW 13 67749458 missense probably damaging 1.00
R7045:Zfp85 UTSW 13 67749593 missense probably benign 0.00
R7391:Zfp85 UTSW 13 67749291 missense probably damaging 1.00
R7438:Zfp85 UTSW 13 67748945 missense probably benign 0.09
R7544:Zfp85 UTSW 13 67749065 missense probably benign 0.02
R8046:Zfp85 UTSW 13 67748979 nonsense probably null
R8112:Zfp85 UTSW 13 67748774 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ATTCCTATCCAAAGTGAGCCGCCC -3'
(R):5'- TCCAAACTCTGCGGTGTTCTCAAAG -3'

Sequencing Primer
(F):5'- TGTCCTGGAAACTATGAGCC -3'
(R):5'- GTTCTCAAAGTTGGGACAGTG -3'
Posted On2014-04-13