Incidental Mutation 'R1512:Tle1'
ID168399
Institutional Source Beutler Lab
Gene Symbol Tle1
Ensembl Gene ENSMUSG00000008305
Gene Nametransducin-like enhancer of split 1
SynonymsC230057C06Rik, Estm14, Grg1, Tle4l
MMRRC Submission 039559-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.728) question?
Stock #R1512 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location72117142-72200919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72141258 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 19 (D19G)
Ref Sequence ENSEMBL: ENSMUSP00000118513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030095] [ENSMUST00000072695] [ENSMUST00000074216] [ENSMUST00000102848] [ENSMUST00000140154]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030095
AA Change: D282G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030095
Gene: ENSMUSG00000008305
AA Change: D282G

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 9.1e-77 PFAM
low complexity region 155 183 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
WD40 484 521 4.18e-2 SMART
WD40 527 568 1.03e-1 SMART
WD40 573 612 9.38e-5 SMART
WD40 615 654 1.14e-8 SMART
WD40 657 695 3.07e1 SMART
WD40 697 736 8.96e-2 SMART
WD40 737 777 4.14e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072695
AA Change: D272G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072481
Gene: ENSMUSG00000008305
AA Change: D272G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.6e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074216
AA Change: D272G

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073839
Gene: ENSMUSG00000008305
AA Change: D272G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 1.3e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102848
AA Change: D280G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099912
Gene: ENSMUSG00000008305
AA Change: D280G

DomainStartEndE-ValueType
Pfam:TLE_N 1 144 1.3e-76 PFAM
low complexity region 153 181 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 290 312 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
WD40 481 518 4.18e-2 SMART
WD40 524 565 1.03e-1 SMART
WD40 570 609 9.38e-5 SMART
WD40 612 651 1.14e-8 SMART
WD40 654 692 3.07e1 SMART
WD40 694 733 8.96e-2 SMART
WD40 734 774 4.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132550
Predicted Effect probably damaging
Transcript: ENSMUST00000140154
AA Change: D19G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118513
Gene: ENSMUSG00000008305
AA Change: D19G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.1076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 95% (79/83)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,195,469 D40E probably benign Het
Acsf2 C T 11: 94,561,398 probably benign Het
Adamts19 C T 18: 59,048,845 H1119Y possibly damaging Het
Akap6 A G 12: 52,937,154 D827G probably damaging Het
Ankrd33b T C 15: 31,367,229 D55G probably damaging Het
Ano5 T A 7: 51,579,568 H569Q probably benign Het
Aox2 A G 1: 58,307,351 D548G probably benign Het
Baz2a A G 10: 128,124,152 D1433G possibly damaging Het
BC031181 T G 18: 75,008,696 V8G probably damaging Het
Bicdl2 A T 17: 23,668,109 M457L probably damaging Het
C130074G19Rik T C 1: 184,882,906 D29G probably damaging Het
Cd200r1 A T 16: 44,766,027 T7S probably benign Het
Cdc37 A G 9: 21,142,416 probably benign Het
Cmtr2 T C 8: 110,222,635 S526P probably damaging Het
Cntn2 G T 1: 132,523,692 A433D probably damaging Het
Cntnap5a T C 1: 115,900,950 S35P probably benign Het
Csf3r A G 4: 126,029,984 T96A possibly damaging Het
Ctbs A G 3: 146,454,965 N96D probably benign Het
Cyp26b1 C A 6: 84,576,997 V213L probably benign Het
Dach1 A G 14: 97,901,399 L536P probably damaging Het
Dcaf6 T C 1: 165,352,020 Q517R probably benign Het
Dnah1 G T 14: 31,293,037 Q1733K probably damaging Het
Dnah17 A T 11: 118,095,015 I1416N probably benign Het
Dock11 G A X: 36,020,035 R1102H probably damaging Het
Dpp8 T C 9: 65,063,814 probably benign Het
Emc1 G A 4: 139,360,184 probably null Het
Emc8 A G 8: 120,658,244 L76P possibly damaging Het
Emx2 T C 19: 59,459,603 Y130H possibly damaging Het
Fbf1 C T 11: 116,147,927 R815Q probably damaging Het
Foxb2 G A 19: 16,872,514 P376L probably damaging Het
Gabrb1 C A 5: 72,108,704 L202I probably damaging Het
Gabrb1 T A 5: 72,108,705 L202Q probably damaging Het
Grin2c T A 11: 115,253,850 I617F probably damaging Het
Gtf2h3 T A 5: 124,590,870 V164E probably damaging Het
Gusb T C 5: 130,000,890 Q88R probably damaging Het
Hormad2 T A 11: 4,424,788 K75N probably damaging Het
Il33 A G 19: 29,951,990 T38A possibly damaging Het
Ivns1abp A T 1: 151,360,936 Q416L possibly damaging Het
Ivns1abp G C 1: 151,360,937 Q416H probably benign Het
Kcnh5 T A 12: 75,119,937 H178L probably benign Het
Kif21b A G 1: 136,152,805 N579S probably benign Het
Kif26a G C 12: 112,146,955 R95P possibly damaging Het
Kl A G 5: 150,988,597 I604V probably benign Het
Klhl24 A G 16: 20,122,936 K545E probably damaging Het
Mcm3ap A G 10: 76,470,513 I153M probably damaging Het
Meis1 T G 11: 18,881,682 D452A probably damaging Het
Msantd4 C T 9: 4,384,138 P153L probably benign Het
Myot A G 18: 44,342,355 E181G probably damaging Het
Nf1 T C 11: 79,390,369 F150S probably damaging Het
Nyap2 T A 1: 81,241,851 S529R probably damaging Het
Olfr1145 A T 2: 87,810,644 T275S probably benign Het
Olfr1386 A G 11: 49,470,459 I103V probably benign Het
Olfr923 T A 9: 38,828,364 Y224* probably null Het
Olfr958 T C 9: 39,550,094 Y259C probably damaging Het
Pcnt C T 10: 76,404,662 probably null Het
Pik3c3 T C 18: 30,322,236 probably null Het
Pkdcc A T 17: 83,220,044 Y217F possibly damaging Het
Pnpla6 C A 8: 3,535,459 probably benign Het
Polr3gl T C 3: 96,580,874 M26V probably benign Het
Ppp1r13b T C 12: 111,872,408 N12S possibly damaging Het
Ppp1r26 G A 2: 28,451,516 R386K probably benign Het
Prdm10 A G 9: 31,337,401 E355G probably damaging Het
Prex2 T C 1: 11,061,330 F41S possibly damaging Het
Prkar1b G T 5: 139,050,673 Y231* probably null Het
Prkdc A T 16: 15,687,404 I857L probably benign Het
Psg21 A T 7: 18,656,500 N10K probably benign Het
Rapgef3 A T 15: 97,757,501 V444E probably benign Het
Rnf17 A T 14: 56,467,786 T716S probably benign Het
Rps6ka1 C T 4: 133,851,004 R577H probably damaging Het
Scn1a A C 2: 66,331,285 N306K possibly damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Ssu2 A G 6: 112,387,998 M1T probably null Het
Stag3 A T 5: 138,297,985 T437S probably benign Het
Tal2 A G 4: 53,786,107 Y96C probably benign Het
Thoc3 A T 13: 54,466,178 probably null Het
Trpm4 A G 7: 45,315,044 I690T probably benign Het
Trpm6 A T 19: 18,875,931 M1772L probably benign Het
Unc5b G A 10: 60,831,475 probably benign Het
Usf3 G T 16: 44,221,198 V2014F probably damaging Het
Utp18 C T 11: 93,885,564 A32T probably benign Het
Wdfy4 A G 14: 32,960,808 V2981A probably damaging Het
Zfp608 A G 18: 54,946,666 V349A probably damaging Het
Znfx1 A C 2: 167,056,317 I229S probably benign Het
Other mutations in Tle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tle1 APN 4 72169118 missense possibly damaging 0.94
IGL00972:Tle1 APN 4 72122400 missense probably damaging 1.00
IGL01548:Tle1 APN 4 72170718 missense probably damaging 1.00
IGL01737:Tle1 APN 4 72197821 splice site probably benign
IGL01798:Tle1 APN 4 72137148 missense probably damaging 1.00
IGL01943:Tle1 APN 4 72122402 missense probably damaging 1.00
PIT4515001:Tle1 UTSW 4 72199319 missense possibly damaging 0.47
R0140:Tle1 UTSW 4 72120185 missense probably damaging 1.00
R0544:Tle1 UTSW 4 72124990 missense probably damaging 1.00
R0603:Tle1 UTSW 4 72118347 missense probably damaging 1.00
R0729:Tle1 UTSW 4 72126442 splice site probably benign
R0786:Tle1 UTSW 4 72199361 missense probably damaging 1.00
R0939:Tle1 UTSW 4 72118534 missense probably damaging 1.00
R1297:Tle1 UTSW 4 72124838 missense probably damaging 1.00
R1465:Tle1 UTSW 4 72139831 missense probably damaging 1.00
R1465:Tle1 UTSW 4 72139831 missense probably damaging 1.00
R1967:Tle1 UTSW 4 72120226 missense probably damaging 1.00
R2218:Tle1 UTSW 4 72199319 missense possibly damaging 0.47
R3713:Tle1 UTSW 4 72126422 missense possibly damaging 0.70
R4367:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4379:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4380:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4655:Tle1 UTSW 4 72145344 missense possibly damaging 0.68
R4662:Tle1 UTSW 4 72137098 missense possibly damaging 0.92
R4731:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4732:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4733:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4812:Tle1 UTSW 4 72145354 missense probably damaging 0.98
R5066:Tle1 UTSW 4 72158267 missense probably benign 0.24
R5288:Tle1 UTSW 4 72141844 missense probably damaging 1.00
R5386:Tle1 UTSW 4 72141844 missense probably damaging 1.00
R5405:Tle1 UTSW 4 72138971 intron probably benign
R5579:Tle1 UTSW 4 72139808 missense probably damaging 1.00
R5590:Tle1 UTSW 4 72124971 missense possibly damaging 0.91
R5762:Tle1 UTSW 4 72120135 splice site probably null
R6617:Tle1 UTSW 4 72141280 missense probably damaging 0.98
R6750:Tle1 UTSW 4 72122450 missense probably damaging 1.00
R7077:Tle1 UTSW 4 72158375 missense probably benign 0.25
R7153:Tle1 UTSW 4 72139061 missense probably benign 0.03
R7156:Tle1 UTSW 4 72170716 missense probably benign 0.15
R7266:Tle1 UTSW 4 72139687 critical splice donor site probably null
R7316:Tle1 UTSW 4 72118292 missense probably benign 0.01
R7478:Tle1 UTSW 4 72137112 missense probably damaging 0.96
R7523:Tle1 UTSW 4 72145418 missense possibly damaging 0.94
R7736:Tle1 UTSW 4 72199334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGTTCCACAAAGGAAATGGCAG -3'
(R):5'- AGAGGATGTTCCTGGGTATTGGTAGAAA -3'

Sequencing Primer
(F):5'- AATGGCAGTGTCACCCAG -3'
(R):5'- CCTGGGTATTGGTAGAAAGATGATTG -3'
Posted On2014-04-13