Incidental Mutation 'R7153:Tle1'
ID554244
Institutional Source Beutler Lab
Gene Symbol Tle1
Ensembl Gene ENSMUSG00000008305
Gene Nametransducin-like enhancer of split 1
SynonymsC230057C06Rik, Estm14, Grg1, Tle4l
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.728) question?
Stock #R7153 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location72117142-72200919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72139061 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 101 (F101I)
Ref Sequence ENSEMBL: ENSMUSP00000118513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030095] [ENSMUST00000072695] [ENSMUST00000074216] [ENSMUST00000102848] [ENSMUST00000140154]
Predicted Effect probably benign
Transcript: ENSMUST00000030095
SMART Domains Protein: ENSMUSP00000030095
Gene: ENSMUSG00000008305

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 9.1e-77 PFAM
low complexity region 155 183 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
WD40 484 521 4.18e-2 SMART
WD40 527 568 1.03e-1 SMART
WD40 573 612 9.38e-5 SMART
WD40 615 654 1.14e-8 SMART
WD40 657 695 3.07e1 SMART
WD40 697 736 8.96e-2 SMART
WD40 737 777 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072695
SMART Domains Protein: ENSMUSP00000072481
Gene: ENSMUSG00000008305

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.6e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074216
SMART Domains Protein: ENSMUSP00000073839
Gene: ENSMUSG00000008305

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 1.3e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102848
SMART Domains Protein: ENSMUSP00000099912
Gene: ENSMUSG00000008305

DomainStartEndE-ValueType
Pfam:TLE_N 1 144 1.3e-76 PFAM
low complexity region 153 181 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 290 312 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
WD40 481 518 4.18e-2 SMART
WD40 524 565 1.03e-1 SMART
WD40 570 609 9.38e-5 SMART
WD40 612 651 1.14e-8 SMART
WD40 654 692 3.07e1 SMART
WD40 694 733 8.96e-2 SMART
WD40 734 774 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140154
AA Change: F101I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118513
Gene: ENSMUSG00000008305
AA Change: F101I

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,992,943 T741A possibly damaging Het
Aox4 T C 1: 58,250,219 M767T probably damaging Het
Arhgap39 C A 15: 76,765,491 S27I probably benign Het
AU018091 T A 7: 3,159,513 M296L probably benign Het
Axin1 A G 17: 26,187,968 T512A probably benign Het
B4galnt3 A T 6: 120,214,968 D602E probably benign Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bsnd A T 4: 106,492,033 D3E probably benign Het
Btbd18 C T 2: 84,666,428 R137* probably null Het
C2cd5 A G 6: 143,019,409 S871P probably benign Het
Cobl G T 11: 12,254,128 P858Q probably damaging Het
Col6a1 C T 10: 76,710,341 probably null Het
Crb2 A T 2: 37,787,408 H304L probably benign Het
Crybg1 T A 10: 43,964,666 Y1812F possibly damaging Het
Ddx60 A T 8: 61,988,108 K1070N possibly damaging Het
Defb22 T C 2: 152,485,920 K115R unknown Het
Dhx8 C T 11: 101,740,175 probably null Het
Dnah5 T A 15: 28,365,522 probably null Het
Dnah7b T A 1: 46,126,804 F543Y probably benign Het
Ehhadh A G 16: 21,766,321 F270S probably damaging Het
Esyt2 A G 12: 116,346,508 M397V probably benign Het
Fanca A T 8: 123,316,425 L74H probably damaging Het
Fbxl17 C A 17: 63,060,351 V676F probably benign Het
Fndc1 A G 17: 7,801,645 V102A probably damaging Het
Gpalpp1 T C 14: 76,095,011 Y273C probably damaging Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Grik2 T C 10: 49,535,367 H225R probably benign Het
Helz2 A T 2: 181,231,285 S2411T probably benign Het
Hnmt C T 2: 24,014,341 A103T probably damaging Het
Ighv15-2 G T 12: 114,564,590 Y114* probably null Het
Irak2 A G 6: 113,678,709 H357R probably benign Het
Kcp T C 6: 29,499,015 E320G probably damaging Het
Kpna4 A G 3: 69,089,798 L352S probably damaging Het
Krt36 G A 11: 100,105,146 Q151* probably null Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lca5l T A 16: 96,173,809 N305I probably damaging Het
Lefty1 T A 1: 180,937,767 L300Q probably benign Het
Mertk A G 2: 128,736,649 Y185C probably damaging Het
Mmp14 T C 14: 54,436,251 I124T possibly damaging Het
Nlrc4 T C 17: 74,447,103 E95G possibly damaging Het
Npc1 A G 18: 12,213,291 F283L possibly damaging Het
Olfr1180 A C 2: 88,412,118 L180W probably damaging Het
Olfr1282 A T 2: 111,335,901 M59K probably damaging Het
Pcdha11 T C 18: 37,011,225 V123A probably damaging Het
Pcdhga2 T C 18: 37,669,208 V35A probably damaging Het
Pgd G T 4: 149,161,678 T94K probably benign Het
Pik3c2a T C 7: 116,342,252 N1593S probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb3 A G 19: 6,958,084 probably null Het
Prkd3 C T 17: 78,966,355 D491N probably benign Het
Ptprf T C 4: 118,231,543 T688A probably damaging Het
Pycr2 T A 1: 180,906,682 L210M probably damaging Het
Rpl36 T C 17: 56,614,137 I81T probably benign Het
Rraga C T 4: 86,576,016 A33V probably damaging Het
Slc29a1 G A 17: 45,585,762 A429V probably damaging Het
Stab1 T G 14: 31,160,584 E432A probably benign Het
Synj1 C T 16: 90,948,090 G1189R probably benign Het
Synpo2 A G 3: 123,112,404 *1088Q probably null Het
Tbc1d21 T C 9: 58,363,093 D133G probably damaging Het
Tenm2 A G 11: 36,024,182 V2176A probably damaging Het
Tff1 A G 17: 31,162,798 I35T probably benign Het
Thnsl1 T C 2: 21,212,953 V506A possibly damaging Het
Timm10b A G 7: 105,640,880 Q50R unknown Het
Tjp2 A T 19: 24,101,981 N843K probably benign Het
Tmem225 T C 9: 40,148,368 F15L probably benign Het
Trav12-3 T C 14: 53,622,161 L88P probably benign Het
Ttc7b A T 12: 100,355,034 W613R probably damaging Het
Ttn T A 2: 76,778,504 M17723L probably benign Het
Ttn T C 2: 76,945,316 D1840G unknown Het
Tubgcp2 T C 7: 140,001,036 H668R probably benign Het
Ush2a C A 1: 188,728,484 N2647K possibly damaging Het
Vmn1r14 C T 6: 57,233,866 S143F probably benign Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Ywhab T C 2: 164,014,060 F119L probably damaging Het
Zmym2 T A 14: 56,950,202 D1108E probably benign Het
Other mutations in Tle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tle1 APN 4 72169118 missense possibly damaging 0.94
IGL00972:Tle1 APN 4 72122400 missense probably damaging 1.00
IGL01548:Tle1 APN 4 72170718 missense probably damaging 1.00
IGL01737:Tle1 APN 4 72197821 splice site probably benign
IGL01798:Tle1 APN 4 72137148 missense probably damaging 1.00
IGL01943:Tle1 APN 4 72122402 missense probably damaging 1.00
PIT4515001:Tle1 UTSW 4 72199319 missense possibly damaging 0.47
R0140:Tle1 UTSW 4 72120185 missense probably damaging 1.00
R0544:Tle1 UTSW 4 72124990 missense probably damaging 1.00
R0603:Tle1 UTSW 4 72118347 missense probably damaging 1.00
R0729:Tle1 UTSW 4 72126442 splice site probably benign
R0786:Tle1 UTSW 4 72199361 missense probably damaging 1.00
R0939:Tle1 UTSW 4 72118534 missense probably damaging 1.00
R1297:Tle1 UTSW 4 72124838 missense probably damaging 1.00
R1465:Tle1 UTSW 4 72139831 missense probably damaging 1.00
R1465:Tle1 UTSW 4 72139831 missense probably damaging 1.00
R1512:Tle1 UTSW 4 72141258 missense probably damaging 1.00
R1967:Tle1 UTSW 4 72120226 missense probably damaging 1.00
R2218:Tle1 UTSW 4 72199319 missense possibly damaging 0.47
R3713:Tle1 UTSW 4 72126422 missense possibly damaging 0.70
R4367:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4379:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4380:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4655:Tle1 UTSW 4 72145344 missense possibly damaging 0.68
R4662:Tle1 UTSW 4 72137098 missense possibly damaging 0.92
R4731:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4732:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4733:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4812:Tle1 UTSW 4 72145354 missense probably damaging 0.98
R5066:Tle1 UTSW 4 72158267 missense probably benign 0.24
R5288:Tle1 UTSW 4 72141844 missense probably damaging 1.00
R5386:Tle1 UTSW 4 72141844 missense probably damaging 1.00
R5405:Tle1 UTSW 4 72138971 intron probably benign
R5579:Tle1 UTSW 4 72139808 missense probably damaging 1.00
R5590:Tle1 UTSW 4 72124971 missense possibly damaging 0.91
R5762:Tle1 UTSW 4 72120135 splice site probably null
R6617:Tle1 UTSW 4 72141280 missense probably damaging 0.98
R6750:Tle1 UTSW 4 72122450 missense probably damaging 1.00
R7077:Tle1 UTSW 4 72158375 missense probably benign 0.25
R7156:Tle1 UTSW 4 72170716 missense probably benign 0.15
R7266:Tle1 UTSW 4 72139687 critical splice donor site probably null
R7316:Tle1 UTSW 4 72118292 missense probably benign 0.01
R7478:Tle1 UTSW 4 72137112 missense probably damaging 0.96
R7523:Tle1 UTSW 4 72145418 missense possibly damaging 0.94
R7736:Tle1 UTSW 4 72199334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCATTCCTCAAGGACAG -3'
(R):5'- TCTTCAGGAGTCAGGAAGTTGG -3'

Sequencing Primer
(F):5'- ATTTCCTCATTGGCAAAGCAGC -3'
(R):5'- GGAGGTTTTGCTAATACTCTAGCCC -3'
Posted On2019-05-15