Incidental Mutation 'R1502:Ddx46'
ID169391
Institutional Source Beutler Lab
Gene Symbol Ddx46
Ensembl Gene ENSMUSG00000021500
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Synonyms
MMRRC Submission 039552-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R1502 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55635027-55681256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55663309 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 573 (R573G)
Ref Sequence ENSEMBL: ENSMUSP00000153328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099479] [ENSMUST00000172272] [ENSMUST00000223736]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099479
AA Change: R569G

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097078
Gene: ENSMUSG00000021500
AA Change: R569G

DomainStartEndE-ValueType
low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 4e-76 BLAST
DEXDc 391 592 3.27e-49 SMART
HELICc 629 710 1.55e-27 SMART
low complexity region 760 776 N/A INTRINSIC
low complexity region 798 813 N/A INTRINSIC
internal_repeat_1 855 894 6.68e-7 PROSPERO
low complexity region 911 925 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172272
AA Change: R573G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133245
Gene: ENSMUSG00000021500
AA Change: R573G

DomainStartEndE-ValueType
low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 5e-76 BLAST
DEXDc 391 596 8.03e-67 SMART
HELICc 633 714 1.55e-27 SMART
low complexity region 764 780 N/A INTRINSIC
low complexity region 802 817 N/A INTRINSIC
internal_repeat_1 859 898 1.04e-6 PROSPERO
low complexity region 915 929 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223736
AA Change: R573G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224551
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the 17S U2 snRNP complex; it plays an important role in pre-mRNA splicing. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T G 11: 109,974,645 T329P probably damaging Het
Adamts4 C A 1: 171,258,990 P784T probably damaging Het
Adamts6 T C 13: 104,493,637 L1096P probably damaging Het
Ap1b1 A G 11: 5,040,290 S849G probably benign Het
Arap2 T C 5: 62,604,404 S1660G probably benign Het
Atp10b A C 11: 43,230,347 T946P probably damaging Het
Brpf1 A G 6: 113,322,420 D1103G probably damaging Het
Bub1 A G 2: 127,827,419 Y102H probably damaging Het
C87499 T A 4: 88,628,032 I358F probably benign Het
Ccdc182 A G 11: 88,294,367 E91G probably benign Het
Cd200r4 C T 16: 44,833,440 T154M probably damaging Het
Cdh20 A G 1: 104,954,030 T407A probably benign Het
Col6a2 T C 10: 76,614,678 I140V probably benign Het
Csn3 C A 5: 87,930,124 T163K probably damaging Het
Dars2 A T 1: 161,046,805 L438* probably null Het
Dbr1 T C 9: 99,582,387 L289P probably damaging Het
Defb10 T C 8: 21,858,956 I10T possibly damaging Het
Dis3l T C 9: 64,325,787 E136G possibly damaging Het
Dnajb13 T C 7: 100,507,461 Q136R probably benign Het
Dse A T 10: 34,153,218 S625R probably damaging Het
Dvl3 A G 16: 20,523,459 D94G probably damaging Het
E130311K13Rik A C 3: 63,915,547 Y225* probably null Het
Etnppl A G 3: 130,628,789 I222V probably benign Het
Evc2 T C 5: 37,393,096 L818P probably benign Het
Fbn1 A T 2: 125,363,706 C1083* probably null Het
Flnc G A 6: 29,438,694 V196I probably benign Het
Fscn3 A G 6: 28,435,623 D415G probably benign Het
Gm3448 A G 17: 14,967,614 F133L probably benign Het
Gm4861 A C 3: 137,550,620 V75G probably damaging Het
Gpld1 A T 13: 24,971,416 T345S probably benign Het
Grik4 T C 9: 42,520,873 S943G probably damaging Het
Grik4 C T 9: 42,591,447 R460Q probably benign Het
Ifi207 A C 1: 173,729,306 L629R possibly damaging Het
Ift52 G A 2: 163,029,862 probably null Het
Insl3 A G 8: 71,690,232 D79G probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Lag3 T C 6: 124,909,243 Y249C probably damaging Het
Lipe T C 7: 25,398,147 N124D possibly damaging Het
Lnpep A G 17: 17,571,644 Y412H probably damaging Het
Lrtm2 A G 6: 119,317,274 Y299H probably benign Het
Lypd4 T C 7: 24,866,828 T24A probably benign Het
Magi1 T A 6: 93,694,170 I805F probably damaging Het
Mfap3 T C 11: 57,528,149 L45P probably benign Het
Nbea G A 3: 56,004,889 P1159L probably benign Het
Ndst4 A T 3: 125,437,758 probably benign Het
Notch1 A T 2: 26,484,323 N229K possibly damaging Het
Nova1 A G 12: 46,720,832 I102T unknown Het
Npepps T C 11: 97,218,575 E725G possibly damaging Het
Olfr1157 T C 2: 87,962,035 N286D probably damaging Het
Olfr211 T C 6: 116,494,281 I224T probably damaging Het
Olfr743 A T 14: 50,533,777 M122L possibly damaging Het
Olfr822 T C 10: 130,074,872 I154T probably damaging Het
Pappa2 A T 1: 158,957,288 W51R probably damaging Het
Pde8a T C 7: 81,292,259 S149P probably damaging Het
Phkb T A 8: 86,059,339 L1052Q possibly damaging Het
Pou5f2 T A 13: 78,025,251 L104Q probably benign Het
Psme2b A T 11: 48,945,749 W124R probably damaging Het
Ptk2b G A 14: 66,163,080 S762L possibly damaging Het
Ptprs T C 17: 56,437,992 N248S probably benign Het
Rgs22 G A 15: 36,080,851 T705I probably damaging Het
Rnf123 T C 9: 108,068,510 probably null Het
Sel1l2 A T 2: 140,389,595 I13N probably damaging Het
Slc39a4 T C 15: 76,616,593 T57A probably benign Het
Smpdl3a T G 10: 57,809,091 V319G probably damaging Het
Syt9 T C 7: 107,436,487 L237P probably damaging Het
Tbc1d16 G T 11: 119,154,004 A536E probably damaging Het
Tcf20 T C 15: 82,855,576 D558G probably damaging Het
Tdpoz2 A T 3: 93,652,146 M173K probably benign Het
Tek A G 4: 94,781,102 I113M probably damaging Het
Tmem50a A T 4: 134,909,669 D50E probably benign Het
Tmem8 A G 17: 26,120,316 T535A possibly damaging Het
Trappc11 A T 8: 47,530,827 V10E possibly damaging Het
Vmn1r172 C T 7: 23,660,256 R189* probably null Het
Vmn2r63 A T 7: 42,928,591 D174E possibly damaging Het
Zc3h10 A T 10: 128,544,282 M402K probably damaging Het
Zfp109 T C 7: 24,228,163 H615R probably damaging Het
Zfp982 A C 4: 147,512,669 H161P probably benign Het
Zhx1 A G 15: 58,054,596 F85L probably damaging Het
Other mutations in Ddx46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Ddx46 APN 13 55666332 nonsense probably null
IGL01137:Ddx46 APN 13 55669717 nonsense probably null
IGL01432:Ddx46 APN 13 55638022 splice site probably benign
IGL01575:Ddx46 APN 13 55654183 splice site probably benign
IGL01673:Ddx46 APN 13 55653048 missense probably damaging 1.00
IGL01868:Ddx46 APN 13 55639870 nonsense probably null
IGL01945:Ddx46 APN 13 55655072 nonsense probably null
IGL02106:Ddx46 APN 13 55677603 unclassified probably benign
IGL03288:Ddx46 APN 13 55638094 missense unknown
R0270:Ddx46 UTSW 13 55674104 missense probably benign 0.00
R0631:Ddx46 UTSW 13 55639777 splice site probably benign
R1082:Ddx46 UTSW 13 55655096 missense possibly damaging 0.87
R2081:Ddx46 UTSW 13 55674016 missense probably benign 0.00
R2256:Ddx46 UTSW 13 55647708 missense possibly damaging 0.50
R4366:Ddx46 UTSW 13 55663236 missense probably benign 0.10
R4856:Ddx46 UTSW 13 55638199 missense unknown
R4886:Ddx46 UTSW 13 55638199 missense unknown
R5001:Ddx46 UTSW 13 55652919 missense probably damaging 0.98
R5152:Ddx46 UTSW 13 55659030 missense probably damaging 1.00
R5258:Ddx46 UTSW 13 55653024 missense possibly damaging 0.95
R5278:Ddx46 UTSW 13 55676038 missense probably damaging 0.97
R5806:Ddx46 UTSW 13 55663337 missense possibly damaging 0.93
R6627:Ddx46 UTSW 13 55652935 missense probably benign 0.15
R6659:Ddx46 UTSW 13 55669724 missense probably damaging 1.00
R6838:Ddx46 UTSW 13 55639935 critical splice donor site probably null
R7235:Ddx46 UTSW 13 55663240 missense probably benign 0.01
R7537:Ddx46 UTSW 13 55650478 missense probably damaging 1.00
R7664:Ddx46 UTSW 13 55659051 missense probably damaging 1.00
R7673:Ddx46 UTSW 13 55659159 missense probably benign 0.01
R7704:Ddx46 UTSW 13 55674019 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTCTCTGGCTTCTTCAGCA -3'
(R):5'- TTCAGAAGTGTCCCGCCTACCTCA -3'

Sequencing Primer
(F):5'- CAGCCAGTTCAGGTATACAATAAG -3'
(R):5'- CTCACACAAAACCAAATGATATACTG -3'
Posted On2014-04-13