Incidental Mutation 'R1559:M6pr'
ID170489
Institutional Source Beutler Lab
Gene Symbol M6pr
Ensembl Gene ENSMUSG00000007458
Gene Namemannose-6-phosphate receptor, cation dependent
SynonymsMpr46, CD-MPR
MMRRC Submission 039598-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1559 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location122308720-122317680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122315074 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 122 (I122L)
Ref Sequence ENSEMBL: ENSMUSP00000108229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007602] [ENSMUST00000079560] [ENSMUST00000081849] [ENSMUST00000112600] [ENSMUST00000112610] [ENSMUST00000159252] [ENSMUST00000160163] [ENSMUST00000160696] [ENSMUST00000161054] [ENSMUST00000161739]
Predicted Effect probably benign
Transcript: ENSMUST00000007602
AA Change: I122L

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000007602
Gene: ENSMUSG00000007458
AA Change: I122L

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 4.5e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079560
SMART Domains Protein: ENSMUSP00000078514
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081849
SMART Domains Protein: ENSMUSP00000080532
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112600
SMART Domains Protein: ENSMUSP00000108219
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112610
AA Change: I122L

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108229
Gene: ENSMUSG00000007458
AA Change: I122L

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 3.9e-200 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123093
Predicted Effect probably benign
Transcript: ENSMUST00000159252
SMART Domains Protein: ENSMUSP00000124678
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 46 65 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 195 258 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 328 371 N/A INTRINSIC
coiled coil region 375 401 N/A INTRINSIC
low complexity region 403 435 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 530 542 N/A INTRINSIC
low complexity region 572 583 N/A INTRINSIC
low complexity region 659 677 N/A INTRINSIC
Pfam:zf-FCS 753 788 2.2e-8 PFAM
low complexity region 810 824 N/A INTRINSIC
SAM 898 965 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160163
SMART Domains Protein: ENSMUSP00000125545
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160696
SMART Domains Protein: ENSMUSP00000125580
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 834 941 3.4e-31 PFAM
SAM 943 1010 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161054
SMART Domains Protein: ENSMUSP00000123911
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161739
SMART Domains Protein: ENSMUSP00000125568
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161877
SMART Domains Protein: ENSMUSP00000123854
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type lectin family. P-type lectins play a critical role in lysosome function through the specific transport of mannose-6-phosphate-containing acid hydrolases from the Golgi complex to lysosomes. The encoded protein functions as a homodimer and requires divalent cations for ligand binding. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and display no visible phenotypic abnormalities; however, serum levels of lysosomal enzymes are elevated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,399,180 W3585R probably null Het
Babam1 G C 8: 71,397,780 E18Q probably damaging Het
Bcan G T 3: 87,994,212 S394R probably damaging Het
Birc6 T A 17: 74,692,237 F4653L probably damaging Het
Camsap2 A T 1: 136,282,094 H559Q probably benign Het
Cars2 G T 8: 11,530,430 probably null Het
Ccdc93 T A 1: 121,461,983 probably benign Het
Ccna2 C A 3: 36,570,730 probably benign Het
Cdc6 T A 11: 98,912,211 L326I probably damaging Het
Cdh23 A T 10: 60,419,699 probably benign Het
Cenpe T A 3: 135,270,900 S2423T probably benign Het
Cftr A G 6: 18,225,937 M295V probably benign Het
Cxcl2 A G 5: 90,904,012 H23R probably benign Het
Cyp4a12b A G 4: 115,433,984 T370A probably damaging Het
Daam2 A G 17: 49,496,120 probably benign Het
Dclk3 T C 9: 111,469,208 F607L probably damaging Het
Des T G 1: 75,360,586 S57A probably benign Het
Drd1 A T 13: 54,052,945 S410T probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fanci T C 7: 79,433,193 L639P probably damaging Het
Fancm A G 12: 65,093,689 E395G probably benign Het
Gm996 G T 2: 25,577,031 S956* probably null Het
Grik3 A G 4: 125,707,997 D889G probably benign Het
Heyl A G 4: 123,241,399 S62G probably damaging Het
Hmox1 C T 8: 75,099,949 P267L probably damaging Het
Ifi213 A C 1: 173,567,218 S584A probably benign Het
Il12rb2 G T 6: 67,356,592 F234L probably benign Het
Il4i1 T A 7: 44,839,387 S233T probably damaging Het
Itga4 A G 2: 79,315,688 S745G probably benign Het
Kalrn T A 16: 34,010,548 I734F possibly damaging Het
Klk1b16 T C 7: 44,141,001 I200T probably benign Het
Lrrc4c T A 2: 97,630,772 M581K probably benign Het
Magi3 T C 3: 104,046,853 probably benign Het
Mybpc2 T G 7: 44,513,687 T480P probably benign Het
Olfr301 T C 7: 86,412,367 S43P probably benign Het
Olfr346 A G 2: 36,688,758 Y252C probably damaging Het
Olfr613 A T 7: 103,552,165 I127F possibly damaging Het
Olfr937 T C 9: 39,060,141 N175S probably benign Het
Pcx T A 19: 4,619,086 I704N probably damaging Het
Pde3a G T 6: 141,459,098 A350S probably damaging Het
Ppox A T 1: 171,280,006 probably benign Het
Ppp1r32 T C 19: 10,481,406 T87A probably benign Het
Prb1 T A 6: 132,208,544 Y42F unknown Het
Rsph4a T A 10: 33,909,731 V546E probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sh3tc1 A G 5: 35,703,349 probably null Het
Slc22a2 T C 17: 12,584,411 F44S probably damaging Het
Slco6c1 T A 1: 97,098,498 D334V probably damaging Het
Smim19 T C 8: 22,463,336 D105G probably damaging Het
Smpdl3a A G 10: 57,807,492 T233A probably damaging Het
St8sia5 G A 18: 77,211,764 probably null Het
Stk32a C A 18: 43,243,084 Q73K probably benign Het
Tmem129 G T 5: 33,657,756 probably null Het
Traf3ip3 A T 1: 193,178,291 L441Q probably damaging Het
Ttn C T 2: 76,900,961 probably benign Het
Unc45b T C 11: 82,917,846 S253P possibly damaging Het
Vars2 A G 17: 35,666,258 probably benign Het
Vmn2r51 C T 7: 10,102,445 M136I possibly damaging Het
Vmn2r51 A G 7: 10,102,446 M136T possibly damaging Het
Zfp595 T C 13: 67,317,063 I379V possibly damaging Het
Other mutations in M6pr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:M6pr APN 6 122313378 missense probably damaging 0.99
IGL00899:M6pr APN 6 122315395 missense possibly damaging 0.60
IGL01291:M6pr APN 6 122312259 missense probably benign 0.08
IGL02010:M6pr APN 6 122315126 missense possibly damaging 0.70
IGL02200:M6pr APN 6 122315068 missense probably benign 0.25
ANU05:M6pr UTSW 6 122312259 missense probably benign 0.08
R2015:M6pr UTSW 6 122313373 missense probably damaging 0.99
R2144:M6pr UTSW 6 122315367 missense probably benign 0.04
R4402:M6pr UTSW 6 122315023 unclassified probably benign
R4466:M6pr UTSW 6 122313269 missense probably benign 0.23
R5270:M6pr UTSW 6 122315089 missense possibly damaging 0.90
R6306:M6pr UTSW 6 122315162 unclassified probably null
R6393:M6pr UTSW 6 122315380 missense possibly damaging 0.56
R6583:M6pr UTSW 6 122313390 missense probably damaging 0.96
RF016:M6pr UTSW 6 122315165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCAATCTTGTGGAATCCCCTC -3'
(R):5'- TGCATAAAGCCCAATCATTTGCAGC -3'

Sequencing Primer
(F):5'- tgggaggcaaaggcagg -3'
(R):5'- CAATCATTTGCAGCTCCTGG -3'
Posted On2014-04-13