Incidental Mutation 'R1559:Stk32a'
ID170522
Institutional Source Beutler Lab
Gene Symbol Stk32a
Ensembl Gene ENSMUSG00000039954
Gene Nameserine/threonine kinase 32A
SynonymsYANK1, A930015B13Rik
MMRRC Submission 039598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1559 (G1)
Quality Score137
Status Validated
Chromosome18
Chromosomal Location43207697-43317481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43243084 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 73 (Q73K)
Ref Sequence ENSEMBL: ENSMUSP00000038471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045477]
Predicted Effect probably benign
Transcript: ENSMUST00000045477
AA Change: Q73K

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038471
Gene: ENSMUSG00000039954
AA Change: Q73K

DomainStartEndE-ValueType
S_TKc 23 281 9.58e-85 SMART
low complexity region 318 339 N/A INTRINSIC
Meta Mutation Damage Score 0.0861 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,399,180 W3585R probably null Het
Babam1 G C 8: 71,397,780 E18Q probably damaging Het
Bcan G T 3: 87,994,212 S394R probably damaging Het
Birc6 T A 17: 74,692,237 F4653L probably damaging Het
Camsap2 A T 1: 136,282,094 H559Q probably benign Het
Cars2 G T 8: 11,530,430 probably null Het
Ccdc93 T A 1: 121,461,983 probably benign Het
Ccna2 C A 3: 36,570,730 probably benign Het
Cdc6 T A 11: 98,912,211 L326I probably damaging Het
Cdh23 A T 10: 60,419,699 probably benign Het
Cenpe T A 3: 135,270,900 S2423T probably benign Het
Cftr A G 6: 18,225,937 M295V probably benign Het
Cxcl2 A G 5: 90,904,012 H23R probably benign Het
Cyp4a12b A G 4: 115,433,984 T370A probably damaging Het
Daam2 A G 17: 49,496,120 probably benign Het
Dclk3 T C 9: 111,469,208 F607L probably damaging Het
Des T G 1: 75,360,586 S57A probably benign Het
Drd1 A T 13: 54,052,945 S410T probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fanci T C 7: 79,433,193 L639P probably damaging Het
Fancm A G 12: 65,093,689 E395G probably benign Het
Gm996 G T 2: 25,577,031 S956* probably null Het
Grik3 A G 4: 125,707,997 D889G probably benign Het
Heyl A G 4: 123,241,399 S62G probably damaging Het
Hmox1 C T 8: 75,099,949 P267L probably damaging Het
Ifi213 A C 1: 173,567,218 S584A probably benign Het
Il12rb2 G T 6: 67,356,592 F234L probably benign Het
Il4i1 T A 7: 44,839,387 S233T probably damaging Het
Itga4 A G 2: 79,315,688 S745G probably benign Het
Kalrn T A 16: 34,010,548 I734F possibly damaging Het
Klk1b16 T C 7: 44,141,001 I200T probably benign Het
Lrrc4c T A 2: 97,630,772 M581K probably benign Het
M6pr A T 6: 122,315,074 I122L probably benign Het
Magi3 T C 3: 104,046,853 probably benign Het
Mybpc2 T G 7: 44,513,687 T480P probably benign Het
Olfr301 T C 7: 86,412,367 S43P probably benign Het
Olfr346 A G 2: 36,688,758 Y252C probably damaging Het
Olfr613 A T 7: 103,552,165 I127F possibly damaging Het
Olfr937 T C 9: 39,060,141 N175S probably benign Het
Pcx T A 19: 4,619,086 I704N probably damaging Het
Pde3a G T 6: 141,459,098 A350S probably damaging Het
Ppox A T 1: 171,280,006 probably benign Het
Ppp1r32 T C 19: 10,481,406 T87A probably benign Het
Prb1 T A 6: 132,208,544 Y42F unknown Het
Rsph4a T A 10: 33,909,731 V546E probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sh3tc1 A G 5: 35,703,349 probably null Het
Slc22a2 T C 17: 12,584,411 F44S probably damaging Het
Slco6c1 T A 1: 97,098,498 D334V probably damaging Het
Smim19 T C 8: 22,463,336 D105G probably damaging Het
Smpdl3a A G 10: 57,807,492 T233A probably damaging Het
St8sia5 G A 18: 77,211,764 probably null Het
Tmem129 G T 5: 33,657,756 probably null Het
Traf3ip3 A T 1: 193,178,291 L441Q probably damaging Het
Ttn C T 2: 76,900,961 probably benign Het
Unc45b T C 11: 82,917,846 S253P possibly damaging Het
Vars2 A G 17: 35,666,258 probably benign Het
Vmn2r51 C T 7: 10,102,445 M136I possibly damaging Het
Vmn2r51 A G 7: 10,102,446 M136T possibly damaging Het
Zfp595 T C 13: 67,317,063 I379V possibly damaging Het
Other mutations in Stk32a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Stk32a APN 18 43310445 missense possibly damaging 0.46
IGL00704:Stk32a APN 18 43261249 missense probably damaging 1.00
IGL00813:Stk32a APN 18 43310520 missense probably benign 0.10
IGL02121:Stk32a APN 18 43313507 missense probably benign
IGL02407:Stk32a APN 18 43297511 missense probably benign 0.00
IGL02957:Stk32a APN 18 43311992 missense probably benign
R0004:Stk32a UTSW 18 43305056 missense probably damaging 1.00
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0288:Stk32a UTSW 18 43304995 splice site probably null
R0330:Stk32a UTSW 18 43313501 missense probably benign 0.15
R1337:Stk32a UTSW 18 43261349 missense probably benign 0.00
R1695:Stk32a UTSW 18 43313420 nonsense probably null
R1874:Stk32a UTSW 18 43261316 missense probably damaging 1.00
R1954:Stk32a UTSW 18 43212025 missense probably benign 0.45
R4529:Stk32a UTSW 18 43242979 missense possibly damaging 0.83
R4980:Stk32a UTSW 18 43314048 missense probably benign 0.01
R5124:Stk32a UTSW 18 43305017 missense probably benign 0.00
R5751:Stk32a UTSW 18 43305020 missense possibly damaging 0.74
R5822:Stk32a UTSW 18 43313487 missense probably benign 0.00
R5863:Stk32a UTSW 18 43315144 missense probably benign 0.00
R6167:Stk32a UTSW 18 43313409 missense probably damaging 1.00
R6355:Stk32a UTSW 18 43297594 splice site probably null
R6731:Stk32a UTSW 18 43305078 missense probably damaging 1.00
R7162:Stk32a UTSW 18 43297584 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTCTCTGCCATGCTGAAGAAC -3'
(R):5'- AAGCTTGATTCCCAGCACAGCGAC -3'

Sequencing Primer
(F):5'- GCTGAAGAACAAATCTCACCTTGTG -3'
(R):5'- GTCACATACAGTCAGTCCATTAAAAG -3'
Posted On2014-04-13