Incidental Mutation 'R1563:Trhr'
ID170790
Institutional Source Beutler Lab
Gene Symbol Trhr
Ensembl Gene ENSMUSG00000038760
Gene Namethyrotropin releasing hormone receptor
SynonymsTRH-R1
MMRRC Submission 039602-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1563 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location44196135-44235912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44197101 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 6 (V6I)
Ref Sequence ENSEMBL: ENSMUSP00000154140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038856] [ENSMUST00000110289] [ENSMUST00000226626] [ENSMUST00000227505]
Predicted Effect probably benign
Transcript: ENSMUST00000038856
AA Change: V6I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036320
Gene: ENSMUSG00000038760
AA Change: V6I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 177 1.6e-7 PFAM
Pfam:7TM_GPCR_Srsx 36 335 4.8e-12 PFAM
Pfam:7tm_1 42 320 1.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110289
AA Change: V6I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105918
Gene: ENSMUSG00000038760
AA Change: V6I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 175 1.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 36 335 4.8e-12 PFAM
Pfam:7tm_1 42 320 1.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226626
AA Change: V6I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227505
AA Change: V6I

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor for thyrotropin-releasing hormone (TRH). Upon binding to TRH, this receptor activates the inositol phospholipid-calcium-protein kinase C transduction pathway. Mutations in this gene have been associated with generalized thyrotropin-releasing hormone resistance. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice are fertile and display decreased thyroxine, triiodothyronine, and prolactin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,719,534 Y707C probably damaging Het
4930519G04Rik T C 5: 114,863,508 M22T probably benign Het
A930018M24Rik A G 14: 50,897,119 L22P probably damaging Het
Aipl1 A T 11: 72,036,712 M59K probably damaging Het
Atg2b T C 12: 105,623,488 I1835V probably damaging Het
Cacna1i T C 15: 80,321,188 V115A probably damaging Het
Cacna1i A T 15: 80,389,855 probably benign Het
Catsperb T A 12: 101,588,102 M685K probably damaging Het
Cdh10 T A 15: 18,986,767 Y361* probably null Het
Clcn4 C T 7: 7,293,982 C219Y probably damaging Het
Cpeb2 G A 5: 43,285,737 V924M probably damaging Het
Cpxm2 T C 7: 132,143,682 E138G probably benign Het
Dennd1a T C 2: 37,858,429 Y346C probably damaging Het
Dnah8 T A 17: 30,635,664 L100Q probably benign Het
Dnajc6 A C 4: 101,599,137 N76T probably damaging Het
Ehbp1 A G 11: 22,059,231 L954P probably damaging Het
Eral1 A T 11: 78,075,406 D315E probably benign Het
Fam129a A T 1: 151,715,673 Y522F possibly damaging Het
Fbln2 G T 6: 91,263,383 E724* probably null Het
Fyco1 A G 9: 123,827,182 probably benign Het
Fzd3 T A 14: 65,235,724 E198D probably damaging Het
Fzd9 T C 5: 135,250,554 N159S probably damaging Het
Galnt6 T A 15: 100,703,378 Q340L probably benign Het
Gm20939 C T 17: 94,877,094 A390V probably damaging Het
Gm5435 T G 12: 82,495,690 noncoding transcript Het
Gm9949 A C 18: 62,184,018 probably benign Het
Gprc5b G A 7: 118,983,761 T295I probably benign Het
Gria2 G T 3: 80,691,397 Q777K probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haao T C 17: 83,834,889 T174A probably benign Het
Hes6 A T 1: 91,413,136 M1K probably null Het
Hook3 G T 8: 26,110,752 Q43K probably benign Het
Klhl35 T C 7: 99,471,695 V390A probably damaging Het
Myh9 G T 15: 77,771,857 T1151K probably damaging Het
Nbn A T 4: 15,981,668 I587F possibly damaging Het
Nek4 A G 14: 30,982,451 D696G probably damaging Het
Nlrp2 T C 7: 5,308,725 D52G probably damaging Het
Oit3 G T 10: 59,428,074 R413S probably damaging Het
Olfr1298 T A 2: 111,645,682 H105L probably damaging Het
Olfr786 A G 10: 129,437,711 M300V probably benign Het
Otof T C 5: 30,371,005 T1870A probably benign Het
Pdgfd T C 9: 6,293,939 probably null Het
Pitrm1 T C 13: 6,563,470 V526A possibly damaging Het
Pknox1 T C 17: 31,595,282 S194P probably damaging Het
Plekhg5 T C 4: 152,096,809 S8P probably benign Het
Ppp1r13b T C 12: 111,840,982 E157G probably damaging Het
Psmd3 C T 11: 98,694,225 R466W probably damaging Het
Ptgfrn A G 3: 101,060,651 F542S possibly damaging Het
Ptgs1 A T 2: 36,245,202 M393L possibly damaging Het
Qpct T A 17: 79,064,063 S87T probably benign Het
Qtrt1 T A 9: 21,419,311 V269D probably benign Het
Rassf9 C G 10: 102,544,960 R68G probably damaging Het
Rif1 A G 2: 52,073,223 E25G probably damaging Het
Rnf213 T C 11: 119,414,526 F528L probably benign Het
Sgip1 T C 4: 102,966,260 S693P probably benign Het
She A G 3: 89,854,614 D460G probably benign Het
Sipa1l1 G T 12: 82,341,161 V54L probably benign Het
Slc8a3 T A 12: 81,205,007 D640V possibly damaging Het
Smurf1 T A 5: 144,882,513 E601D probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Synpo2l A G 14: 20,661,278 S425P probably damaging Het
Tbck T C 3: 132,715,693 V187A possibly damaging Het
Tcf23 A T 5: 30,968,831 H18L probably benign Het
Tcp11l2 A G 10: 84,584,944 S16G probably damaging Het
Tekt2 T A 4: 126,323,407 M233L probably benign Het
Tex14 T C 11: 87,536,808 S29P probably damaging Het
Tjp2 T A 19: 24,132,703 N59I probably damaging Het
Tlr5 G A 1: 182,975,010 M626I probably benign Het
Tnn A T 1: 160,125,415 V685D probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim30c C T 7: 104,382,951 R301Q probably benign Het
Usp51 T C X: 153,007,992 I194T probably benign Het
Vmn2r63 A G 7: 42,904,126 S569P probably benign Het
Vps26a T G 10: 62,464,680 I236L probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zcchc14 T C 8: 121,603,979 M882V probably benign Het
Zfhx2 A G 14: 55,065,088 V1813A probably benign Het
Zswim2 C T 2: 83,915,282 G604D possibly damaging Het
Zzef1 C T 11: 72,848,733 Q669* probably null Het
Other mutations in Trhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Trhr APN 15 44229312 missense probably damaging 1.00
IGL01800:Trhr APN 15 44229207 missense possibly damaging 0.69
IGL01945:Trhr APN 15 44197144 missense probably damaging 0.99
IGL02608:Trhr APN 15 44197678 missense probably benign 0.08
IGL02825:Trhr APN 15 44229525 missense possibly damaging 0.62
pushover UTSW 15 44197627 missense probably damaging 1.00
P4717OSA:Trhr UTSW 15 44197435 missense probably damaging 0.97
R0007:Trhr UTSW 15 44229151 splice site probably benign
R0276:Trhr UTSW 15 44197086 start codon destroyed probably null 0.74
R0620:Trhr UTSW 15 44229500 missense probably benign 0.01
R1728:Trhr UTSW 15 44197153 missense probably damaging 1.00
R1729:Trhr UTSW 15 44197153 missense probably damaging 1.00
R2144:Trhr UTSW 15 44197183 missense probably benign 0.44
R2167:Trhr UTSW 15 44229242 missense probably damaging 1.00
R3965:Trhr UTSW 15 44197699 missense possibly damaging 0.70
R4246:Trhr UTSW 15 44233460 critical splice acceptor site probably null
R4272:Trhr UTSW 15 44197224 missense probably damaging 0.97
R4378:Trhr UTSW 15 44197627 missense probably damaging 1.00
R4618:Trhr UTSW 15 44197641 missense probably benign 0.00
R5093:Trhr UTSW 15 44197584 missense probably damaging 0.96
R5388:Trhr UTSW 15 44197477 missense possibly damaging 0.91
R5496:Trhr UTSW 15 44197536 missense probably benign 0.00
R6341:Trhr UTSW 15 44229298 nonsense probably null
R6463:Trhr UTSW 15 44197585 missense probably benign 0.09
R6575:Trhr UTSW 15 44229206 missense possibly damaging 0.83
R7483:Trhr UTSW 15 44229231 missense probably damaging 1.00
Y5406:Trhr UTSW 15 44197641 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTTGACCATAGCACCCTTTG -3'
(R):5'- GAGATCTGCCACAGCCAGACTTAC -3'

Sequencing Primer
(F):5'- TTGGACCCAGTTTCAAAACAGG -3'
(R):5'- ACTTACCAGGTAACAGTTTGTAGGG -3'
Posted On2014-04-13