Incidental Mutation 'R1599:Kansl3'
ID175993
Institutional Source Beutler Lab
Gene Symbol Kansl3
Ensembl Gene ENSMUSG00000010453
Gene NameKAT8 regulatory NSL complex subunit 3
Synonyms
MMRRC Submission 039636-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location36335730-36369181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36367870 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 38 (D38E)
Ref Sequence ENSEMBL: ENSMUSP00000140597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010597] [ENSMUST00000179162] [ENSMUST00000185621] [ENSMUST00000185912] [ENSMUST00000186470] [ENSMUST00000187628] [ENSMUST00000188528] [ENSMUST00000188957] [ENSMUST00000188961]
Predicted Effect probably damaging
Transcript: ENSMUST00000010597
AA Change: D38E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010597
Gene: ENSMUSG00000010453
AA Change: D38E

DomainStartEndE-ValueType
low complexity region 113 125 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:Abhydrolase_5 288 436 2e-9 PFAM
low complexity region 523 555 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 718 732 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179162
SMART Domains Protein: ENSMUSP00000142130
Gene: ENSMUSG00000037432

DomainStartEndE-ValueType
C2 1 98 2.74e-4 SMART
C2 168 264 4.29e-6 SMART
FerI 250 323 1.59e-19 SMART
C2 325 422 1.06e-5 SMART
FerA 602 669 6.26e-18 SMART
FerB 691 764 1.38e-37 SMART
internal_repeat_1 781 836 1.77e-5 PROSPERO
internal_repeat_1 852 904 1.77e-5 PROSPERO
DysFC 913 951 1.61e-3 SMART
DysFC 981 1013 4.81e-2 SMART
C2 1078 1222 1.56e0 SMART
Pfam:C2 1248 1329 1e-1 PFAM
low complexity region 1376 1387 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
C2 1487 1586 2.21e-8 SMART
C2 1659 1851 5.32e-2 SMART
transmembrane domain 1964 1986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185614
Predicted Effect probably damaging
Transcript: ENSMUST00000185621
AA Change: D38E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000185912
SMART Domains Protein: ENSMUSP00000140547
Gene: ENSMUSG00000010453

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 172 186 N/A INTRINSIC
Pfam:Abhydrolase_5 189 337 9.3e-8 PFAM
low complexity region 424 456 N/A INTRINSIC
low complexity region 570 598 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186470
AA Change: D38E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140597
Gene: ENSMUSG00000010453
AA Change: D38E

DomainStartEndE-ValueType
low complexity region 113 125 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:Abhydrolase_5 288 436 2.2e-9 PFAM
low complexity region 523 555 N/A INTRINSIC
low complexity region 578 586 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 761 777 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187628
AA Change: D38E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000188528
AA Change: D38E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000188957
Predicted Effect probably damaging
Transcript: ENSMUST00000188961
AA Change: D38E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adam3 T C 8: 24,725,361 D20G possibly damaging Het
Adamts12 T C 15: 11,071,711 S114P probably damaging Het
Adgrg6 T A 10: 14,467,313 R297* probably null Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Axl A G 7: 25,763,969 Y619H probably damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Fam161a A T 11: 23,021,093 M180L probably benign Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Hnrnpll T A 17: 80,053,625 H118L unknown Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Man2a1 T C 17: 64,679,831 Y613H possibly damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr457 T A 6: 42,471,242 K312M probably damaging Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Olfr850 T A 9: 19,478,221 T7S probably damaging Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rab3gap2 C T 1: 185,251,026 T454I probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sacs G A 14: 61,203,638 M1044I probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Kansl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Kansl3 APN 1 36367989 start gained probably benign
IGL02277:Kansl3 APN 1 36348947 missense possibly damaging 0.85
IGL02423:Kansl3 APN 1 36351969 missense probably damaging 1.00
R0147:Kansl3 UTSW 1 36353816 missense probably damaging 1.00
R0148:Kansl3 UTSW 1 36353816 missense probably damaging 1.00
R0255:Kansl3 UTSW 1 36344969 missense probably benign 0.01
R0279:Kansl3 UTSW 1 36351969 missense probably damaging 0.99
R0349:Kansl3 UTSW 1 36351783 missense probably damaging 1.00
R1452:Kansl3 UTSW 1 36354793 splice site probably benign
R1842:Kansl3 UTSW 1 36351744 missense probably damaging 1.00
R2310:Kansl3 UTSW 1 36343364 missense probably damaging 1.00
R4093:Kansl3 UTSW 1 36344954 missense probably damaging 1.00
R4961:Kansl3 UTSW 1 36348683 critical splice acceptor site probably null
R5339:Kansl3 UTSW 1 36367721 intron probably benign
R5400:Kansl3 UTSW 1 36358149 missense possibly damaging 0.93
R5564:Kansl3 UTSW 1 36345964 missense possibly damaging 0.55
R5661:Kansl3 UTSW 1 36348957 missense possibly damaging 0.55
R5965:Kansl3 UTSW 1 36345520 intron probably null
R6185:Kansl3 UTSW 1 36346018 missense probably damaging 0.96
R6261:Kansl3 UTSW 1 36365605 missense probably benign 0.01
R6706:Kansl3 UTSW 1 36344914 critical splice donor site probably null
R7055:Kansl3 UTSW 1 36365620 missense possibly damaging 0.86
R7134:Kansl3 UTSW 1 36351767 missense possibly damaging 0.52
R7362:Kansl3 UTSW 1 36344127 missense possibly damaging 0.82
R7461:Kansl3 UTSW 1 36343795 missense probably damaging 1.00
R7571:Kansl3 UTSW 1 36365587 missense possibly damaging 0.55
R7613:Kansl3 UTSW 1 36343795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTGTCCAACTTTGCCCTGC -3'
(R):5'- ATTCACACCCTGACTTGGCTGC -3'

Sequencing Primer
(F):5'- TGATGCTGCTCATCCAAGC -3'
(R):5'- TGCTTGACTACTGACATGGC -3'
Posted On2014-04-24