Incidental Mutation 'R2310:Kansl3'
ID328530
Institutional Source Beutler Lab
Gene Symbol Kansl3
Ensembl Gene ENSMUSG00000010453
Gene NameKAT8 regulatory NSL complex subunit 3
Synonyms
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R2310 (G1)
Quality Score30
Status Validated
Chromosome1
Chromosomal Location36335730-36369181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36343364 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 860 (I860F)
Ref Sequence ENSEMBL: ENSMUSP00000140597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010597] [ENSMUST00000185912] [ENSMUST00000186470] [ENSMUST00000188961]
Predicted Effect probably damaging
Transcript: ENSMUST00000010597
AA Change: I834F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010597
Gene: ENSMUSG00000010453
AA Change: I834F

DomainStartEndE-ValueType
low complexity region 113 125 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:Abhydrolase_5 288 436 2e-9 PFAM
low complexity region 523 555 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 718 732 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185912
AA Change: I735F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140547
Gene: ENSMUSG00000010453
AA Change: I735F

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 172 186 N/A INTRINSIC
Pfam:Abhydrolase_5 189 337 9.3e-8 PFAM
low complexity region 424 456 N/A INTRINSIC
low complexity region 570 598 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186470
AA Change: I860F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140597
Gene: ENSMUSG00000010453
AA Change: I860F

DomainStartEndE-ValueType
low complexity region 113 125 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:Abhydrolase_5 288 436 2.2e-9 PFAM
low complexity region 523 555 N/A INTRINSIC
low complexity region 578 586 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 761 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188961
Meta Mutation Damage Score 0.1828 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Kansl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Kansl3 APN 1 36367989 start gained probably benign
IGL02277:Kansl3 APN 1 36348947 missense possibly damaging 0.85
IGL02423:Kansl3 APN 1 36351969 missense probably damaging 1.00
R0147:Kansl3 UTSW 1 36353816 missense probably damaging 1.00
R0148:Kansl3 UTSW 1 36353816 missense probably damaging 1.00
R0255:Kansl3 UTSW 1 36344969 missense probably benign 0.01
R0279:Kansl3 UTSW 1 36351969 missense probably damaging 0.99
R0349:Kansl3 UTSW 1 36351783 missense probably damaging 1.00
R1452:Kansl3 UTSW 1 36354793 splice site probably benign
R1599:Kansl3 UTSW 1 36367870 missense probably damaging 1.00
R1842:Kansl3 UTSW 1 36351744 missense probably damaging 1.00
R4093:Kansl3 UTSW 1 36344954 missense probably damaging 1.00
R4961:Kansl3 UTSW 1 36348683 critical splice acceptor site probably null
R5339:Kansl3 UTSW 1 36367721 intron probably benign
R5400:Kansl3 UTSW 1 36358149 missense possibly damaging 0.93
R5564:Kansl3 UTSW 1 36345964 missense possibly damaging 0.55
R5661:Kansl3 UTSW 1 36348957 missense possibly damaging 0.55
R5965:Kansl3 UTSW 1 36345520 intron probably null
R6185:Kansl3 UTSW 1 36346018 missense probably damaging 0.96
R6261:Kansl3 UTSW 1 36365605 missense probably benign 0.01
R6706:Kansl3 UTSW 1 36344914 critical splice donor site probably null
R7055:Kansl3 UTSW 1 36365620 missense possibly damaging 0.86
R7134:Kansl3 UTSW 1 36351767 missense possibly damaging 0.52
R7362:Kansl3 UTSW 1 36344127 missense possibly damaging 0.82
R7461:Kansl3 UTSW 1 36343795 missense probably damaging 1.00
R7571:Kansl3 UTSW 1 36365587 missense possibly damaging 0.55
R7613:Kansl3 UTSW 1 36343795 missense probably damaging 1.00
R7775:Kansl3 UTSW 1 36348677 missense probably damaging 0.99
R7778:Kansl3 UTSW 1 36348677 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCCACATTTACCTAGGACTG -3'
(R):5'- TGGATTCAGCTCTGTGGAAC -3'

Sequencing Primer
(F):5'- ATTTACCTAGGACTGGAACCTGC -3'
(R):5'- CTGCCCTCAGAAAGGTCTAGAG -3'
Posted On2015-07-07