Incidental Mutation 'R1603:Slc22a28'
ID176293
Institutional Source Beutler Lab
Gene Symbol Slc22a28
Ensembl Gene ENSMUSG00000063590
Gene Namesolute carrier family 22, member 28
SynonymsGm5631
MMRRC Submission 039640-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R1603 (G1)
Quality Score185
Status Validated
Chromosome19
Chromosomal Location8062209-8131982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8063309 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 526 (S526P)
Ref Sequence ENSEMBL: ENSMUSP00000067114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065651]
Predicted Effect probably damaging
Transcript: ENSMUST00000065651
AA Change: S526P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067114
Gene: ENSMUSG00000063590
AA Change: S526P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 1.4e-26 PFAM
Pfam:MFS_1 140 375 1.1e-15 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4931408C20Rik T A 1: 26,685,569 R177W probably damaging Het
Ace T A 11: 105,972,099 S315R probably benign Het
Adamtsl1 A G 4: 86,415,530 I1491V probably benign Het
Adrb2 A T 18: 62,179,508 M82K probably damaging Het
Aebp2 A G 6: 140,642,253 N350D probably damaging Het
Ankrd42 T C 7: 92,619,691 probably benign Het
Asap1 A T 15: 64,129,257 C492S probably damaging Het
Atp8b3 C A 10: 80,525,785 A768S probably benign Het
Chga T A 12: 102,564,607 probably null Het
Clca4b A G 3: 144,922,019 V397A probably benign Het
Cntnap5a A C 1: 116,412,101 T697P possibly damaging Het
Col12a1 T C 9: 79,612,962 Q2810R probably damaging Het
Dchs1 G T 7: 105,762,770 R1380S probably benign Het
Dgkg T A 16: 22,570,159 probably benign Het
Dlgap3 G A 4: 127,195,228 G206R probably damaging Het
Dnah5 A G 15: 28,294,985 probably benign Het
Dnah5 A T 15: 28,449,180 I4243L probably benign Het
Fbxw22 G T 9: 109,378,847 P452H probably benign Het
Fgl1 T A 8: 41,197,018 D242V probably damaging Het
Gba2 C T 4: 43,567,823 G794R probably damaging Het
Gimap7 A T 6: 48,723,930 D150V probably damaging Het
Gm5334 T C 7: 68,618,872 V13A probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Grk5 T C 19: 61,069,362 F167L probably benign Het
Ice1 A G 13: 70,603,353 L1538P probably benign Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Kmt2a A T 9: 44,841,561 probably null Het
Kras A T 6: 145,225,145 L168* probably null Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Mak T C 13: 41,042,106 D377G possibly damaging Het
Matn2 T C 15: 34,388,768 C335R probably damaging Het
Mcoln2 C T 3: 146,180,222 S276F probably damaging Het
Morc3 C A 16: 93,866,503 N531K probably benign Het
Obp2a G A 2: 25,702,745 S175N probably benign Het
Olfr1437 A T 19: 12,321,984 V281E probably damaging Het
Olfr319 T C 11: 58,702,460 V253A probably benign Het
Olfr733 T G 14: 50,299,034 I92L possibly damaging Het
Osbpl3 C A 6: 50,323,093 K510N probably damaging Het
Papd4 G A 13: 93,175,565 A209V probably benign Het
Pcnx2 G A 8: 125,839,626 S1026F probably damaging Het
Pom121l2 A T 13: 21,983,344 D595V probably damaging Het
Poteg T A 8: 27,448,005 M1K probably null Het
Rbl1 G A 2: 157,175,659 L547F possibly damaging Het
Rpap3 T C 15: 97,701,121 T82A possibly damaging Het
Sema7a G A 9: 57,960,676 D512N probably benign Het
Sgpl1 C T 10: 61,105,451 V294M possibly damaging Het
Trim30b T G 7: 104,365,812 Q123P possibly damaging Het
Trpm5 A G 7: 143,085,209 L275P probably benign Het
Ttc33 A G 15: 5,189,794 E71G probably damaging Het
Unc13d T C 11: 116,073,655 T288A possibly damaging Het
Unc93a T A 17: 13,109,634 E444V probably benign Het
Usf3 T A 16: 44,218,172 M1005K probably benign Het
Vmn2r91 T C 17: 18,106,143 I230T probably benign Het
Wdr49 G A 3: 75,396,870 Q448* probably null Het
Zfp939 T A 7: 39,473,271 noncoding transcript Het
Other mutations in Slc22a28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a28 APN 19 8130203 missense possibly damaging 0.89
IGL00515:Slc22a28 APN 19 8117064 missense probably benign 0.34
IGL01025:Slc22a28 APN 19 8116908 splice site probably benign
IGL02697:Slc22a28 APN 19 8117127 missense probably benign 0.06
PIT4378001:Slc22a28 UTSW 19 8071914 missense probably damaging 0.96
R0744:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R0836:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R1398:Slc22a28 UTSW 19 8130202 nonsense probably null
R1456:Slc22a28 UTSW 19 8071858 missense possibly damaging 0.50
R1993:Slc22a28 UTSW 19 8117124 missense possibly damaging 0.79
R2254:Slc22a28 UTSW 19 8064493 missense probably benign
R2262:Slc22a28 UTSW 19 8071208 missense probably benign 0.00
R4078:Slc22a28 UTSW 19 8101413 missense probably benign 0.15
R4165:Slc22a28 UTSW 19 8063408 missense possibly damaging 0.95
R4612:Slc22a28 UTSW 19 8101406 missense probably damaging 1.00
R4947:Slc22a28 UTSW 19 8131452 missense probably benign 0.03
R5573:Slc22a28 UTSW 19 8071097 missense possibly damaging 0.50
R5611:Slc22a28 UTSW 19 8063333 missense probably damaging 1.00
R5621:Slc22a28 UTSW 19 8071011 missense probably benign 0.00
R5671:Slc22a28 UTSW 19 8131431 missense probably damaging 1.00
R6063:Slc22a28 UTSW 19 8117022 missense probably benign 0.01
R6358:Slc22a28 UTSW 19 8071888 missense probably damaging 0.99
R6385:Slc22a28 UTSW 19 8101480 missense probably damaging 0.99
R6680:Slc22a28 UTSW 19 8101393 missense probably benign 0.07
R6767:Slc22a28 UTSW 19 8117045 missense probably damaging 1.00
R6865:Slc22a28 UTSW 19 8064491 nonsense probably null
R6947:Slc22a28 UTSW 19 8064510 missense possibly damaging 0.58
R7049:Slc22a28 UTSW 19 8071905 missense probably benign
R7269:Slc22a28 UTSW 19 8117127 missense probably benign 0.06
R7484:Slc22a28 UTSW 19 8071127 missense probably benign
R7823:Slc22a28 UTSW 19 8064525 missense probably benign 0.38
R7856:Slc22a28 UTSW 19 8063333 missense probably damaging 1.00
R7980:Slc22a28 UTSW 19 8101473 missense probably damaging 0.99
R8323:Slc22a28 UTSW 19 8131424 missense probably damaging 1.00
R8404:Slc22a28 UTSW 19 8131429 nonsense probably null
R8435:Slc22a28 UTSW 19 8071200 missense probably benign 0.13
R8529:Slc22a28 UTSW 19 8063413 missense probably benign 0.01
Z1088:Slc22a28 UTSW 19 8062398 missense probably damaging 0.96
Z1176:Slc22a28 UTSW 19 8062383 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTGACGTAGAGAGCCTCTAGGAAC -3'
(R):5'- TTGCTCCAAGGGCAACAGGTATG -3'

Sequencing Primer
(F):5'- CGTAGAGAGCCTCTAGGAACATTTG -3'
(R):5'- CAACAGGTATGGGAGTCATTGG -3'
Posted On2014-04-24