Incidental Mutation 'R6358:Slc22a28'
ID513372
Institutional Source Beutler Lab
Gene Symbol Slc22a28
Ensembl Gene ENSMUSG00000063590
Gene Namesolute carrier family 22, member 28
SynonymsGm5631
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8062209-8131982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8071888 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 332 (K332M)
Ref Sequence ENSEMBL: ENSMUSP00000067114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065651]
Predicted Effect probably damaging
Transcript: ENSMUST00000065651
AA Change: K332M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067114
Gene: ENSMUSG00000063590
AA Change: K332M

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 1.4e-26 PFAM
Pfam:MFS_1 140 375 1.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Slc22a28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a28 APN 19 8130203 missense possibly damaging 0.89
IGL00515:Slc22a28 APN 19 8117064 missense probably benign 0.34
IGL01025:Slc22a28 APN 19 8116908 splice site probably benign
IGL02697:Slc22a28 APN 19 8117127 missense probably benign 0.06
PIT4378001:Slc22a28 UTSW 19 8071914 missense probably damaging 0.96
R0744:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R0836:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R1398:Slc22a28 UTSW 19 8130202 nonsense probably null
R1456:Slc22a28 UTSW 19 8071858 missense possibly damaging 0.50
R1603:Slc22a28 UTSW 19 8063309 missense probably damaging 1.00
R1993:Slc22a28 UTSW 19 8117124 missense possibly damaging 0.79
R2254:Slc22a28 UTSW 19 8064493 missense probably benign
R2262:Slc22a28 UTSW 19 8071208 missense probably benign 0.00
R4078:Slc22a28 UTSW 19 8101413 missense probably benign 0.15
R4165:Slc22a28 UTSW 19 8063408 missense possibly damaging 0.95
R4612:Slc22a28 UTSW 19 8101406 missense probably damaging 1.00
R4947:Slc22a28 UTSW 19 8131452 missense probably benign 0.03
R5573:Slc22a28 UTSW 19 8071097 missense possibly damaging 0.50
R5611:Slc22a28 UTSW 19 8063333 missense probably damaging 1.00
R5621:Slc22a28 UTSW 19 8071011 missense probably benign 0.00
R5671:Slc22a28 UTSW 19 8131431 missense probably damaging 1.00
R6063:Slc22a28 UTSW 19 8117022 missense probably benign 0.01
R6385:Slc22a28 UTSW 19 8101480 missense probably damaging 0.99
R6680:Slc22a28 UTSW 19 8101393 missense probably benign 0.07
R6767:Slc22a28 UTSW 19 8117045 missense probably damaging 1.00
R6865:Slc22a28 UTSW 19 8064491 nonsense probably null
R6947:Slc22a28 UTSW 19 8064510 missense possibly damaging 0.58
R7049:Slc22a28 UTSW 19 8071905 missense probably benign
R7269:Slc22a28 UTSW 19 8117127 missense probably benign 0.06
R7484:Slc22a28 UTSW 19 8071127 missense probably benign
R7823:Slc22a28 UTSW 19 8064525 missense probably benign 0.38
R7856:Slc22a28 UTSW 19 8063333 missense probably damaging 1.00
R7939:Slc22a28 UTSW 19 8063333 missense probably damaging 1.00
Z1088:Slc22a28 UTSW 19 8062398 missense probably damaging 0.96
Z1176:Slc22a28 UTSW 19 8062383 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCCTGGCATGAAGTTTGG -3'
(R):5'- ACTTCACTGTAGAAATCCCCTGAG -3'

Sequencing Primer
(F):5'- GGCATGAAGTTTGGATGTACACACTC -3'
(R):5'- GAAATCCCCTGAGTATTTTTGTCTTG -3'
Posted On2018-04-27